Incidental Mutation 'R8192:Slc8a3'
ID635247
Institutional Source Beutler Lab
Gene Symbol Slc8a3
Ensembl Gene ENSMUSG00000079055
Gene Namesolute carrier family 8 (sodium/calcium exchanger), member 3
SynonymsNcx3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8192 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location81197915-81333180 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81199681 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 866 (V866D)
Ref Sequence ENSEMBL: ENSMUSP00000138735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208] [ENSMUST00000182366]
Predicted Effect
SMART Domains Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: V865D

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 79 250 1.3e-36 PFAM
Pfam:Na_Ca_ex_C 253 379 4.6e-57 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.04e-40 SMART
low complexity region 712 723 N/A INTRINSIC
Pfam:Na_Ca_ex 754 919 2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000085238
AA Change: V859D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: V859D

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 79 250 1.3e-36 PFAM
Pfam:Na_Ca_ex_C 253 379 4.6e-57 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.54e-43 SMART
low complexity region 705 716 N/A INTRINSIC
Pfam:Na_Ca_ex 747 912 1.9e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182208
AA Change: V866D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: V866D

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 89 248 8.1e-38 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.04e-40 SMART
low complexity region 712 723 N/A INTRINSIC
Pfam:Na_Ca_ex 764 917 9.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182366
SMART Domains Protein: ENSMUSP00000138803
Gene: ENSMUSG00000079055

DomainStartEndE-ValueType
PDB:2LT9|A 1 52 2e-28 PDB
low complexity region 82 93 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 A T 8: 43,650,933 D558E probably damaging Het
Alox15 T A 11: 70,350,910 E48D probably benign Het
Alyref T C 11: 120,597,696 E102G probably benign Het
Bach2 A G 4: 32,562,294 S254G probably benign Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bcl2l13 A G 6: 120,876,306 E184G possibly damaging Het
Best1 T A 19: 9,986,300 I506F possibly damaging Het
Cd177 T A 7: 24,754,302 D388V probably benign Het
Cep350 T C 1: 155,940,783 K329E possibly damaging Het
Clasrp T C 7: 19,595,462 N65S possibly damaging Het
Cobl T C 11: 12,249,745 R1301G probably benign Het
Cul9 T C 17: 46,538,347 E624G probably benign Het
Cyp21a1 A T 17: 34,803,659 Y109N probably damaging Het
Dbf4 A G 5: 8,398,134 S359P probably benign Het
Ddx60 A G 8: 61,977,968 T846A probably damaging Het
Dnah11 A G 12: 118,012,446 V2746A probably benign Het
Dnah12 G A 14: 26,706,881 A221T probably benign Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Dock2 A G 11: 34,732,339 probably null Het
Dpy19l1 T C 9: 24,450,727 I119V possibly damaging Het
Dsg1c A G 18: 20,266,198 T120A probably damaging Het
Dzank1 T C 2: 144,490,225 H397R probably benign Het
Fam35a A T 14: 34,245,216 S680T probably benign Het
Gaa G T 11: 119,270,409 A93S possibly damaging Het
Galnt4 G A 10: 99,109,256 R281H probably benign Het
Gm13103 G A 4: 143,851,539 W123* probably null Het
Gm3250 T C 10: 77,782,457 E29G unknown Het
Gm5065 T A 7: 5,359,596 D75E possibly damaging Het
H13 T G 2: 152,669,602 D7E probably benign Het
H60c T A 10: 3,259,781 I140F probably benign Het
Hsd3b2 T C 3: 98,713,592 N49S probably benign Het
Klhl11 G T 11: 100,464,096 P300T probably benign Het
Knop1 C A 7: 118,853,146 V117L Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Lrrc9 A T 12: 72,449,389 I13F probably damaging Het
Macf1 A G 4: 123,440,597 S4456P probably damaging Het
Mkrn1 A T 6: 39,399,355 V439D probably damaging Het
Muc2 T A 7: 141,751,478 V612D Het
Nrxn3 A G 12: 90,204,795 N967D probably benign Het
Olfr1173 A C 2: 88,274,944 V35G probably damaging Het
Olfr978 T A 9: 39,994,171 D120E probably damaging Het
Oprm1 C T 10: 6,838,417 P391S probably benign Het
Parp14 T A 16: 35,871,214 E47V probably benign Het
Pikfyve A G 1: 65,246,395 E931G possibly damaging Het
Plcz1 A T 6: 140,023,260 C151S probably damaging Het
Rbm26 A G 14: 105,142,689 probably null Het
Rffl G T 11: 82,812,723 probably null Het
Sc5d T C 9: 42,259,798 I32V probably benign Het
Scube1 A G 15: 83,629,382 probably null Het
Slc12a6 A G 2: 112,351,377 Y714C probably damaging Het
Slc26a3 A G 12: 31,468,542 I670V probably benign Het
Slco3a1 A T 7: 74,320,590 M423K probably benign Het
Smc6 A G 12: 11,299,335 E773G probably benign Het
Son A G 16: 91,655,549 T395A possibly damaging Het
Ss18l1 T C 2: 180,059,362 S290P probably damaging Het
Tcof1 A C 18: 60,843,303 V78G probably damaging Het
Thsd1 G A 8: 22,243,902 V322M probably benign Het
Tln2 A T 9: 67,346,529 C753* probably null Het
Trav6n-6 T A 14: 53,133,040 F83I probably damaging Het
Ttc39d A G 17: 80,216,578 H222R probably damaging Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Upf1 A G 8: 70,340,644 L288P probably benign Het
Zfp442 T C 2: 150,408,709 I424M unknown Het
Zfp580 T C 7: 5,053,115 V100A probably benign Het
Zfpm1 C A 8: 122,332,094 P151Q probably damaging Het
Zfr2 C T 10: 81,242,815 P294S possibly damaging Het
Other mutations in Slc8a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Slc8a3 APN 12 81314569 missense probably benign
IGL01315:Slc8a3 APN 12 81314395 missense probably damaging 0.97
IGL01365:Slc8a3 APN 12 81315376 missense probably damaging 0.99
IGL01610:Slc8a3 APN 12 81315802 missense probably damaging 1.00
IGL02227:Slc8a3 APN 12 81315683 missense probably damaging 1.00
IGL02299:Slc8a3 APN 12 81315224 missense probably damaging 0.98
IGL02548:Slc8a3 APN 12 81204156 splice site probably benign
IGL02646:Slc8a3 APN 12 81315094 missense probably damaging 1.00
IGL03135:Slc8a3 APN 12 81202249 missense probably damaging 1.00
R0050:Slc8a3 UTSW 12 81315265 missense probably damaging 1.00
R0627:Slc8a3 UTSW 12 81314842 missense probably damaging 1.00
R0648:Slc8a3 UTSW 12 81314446 missense probably damaging 1.00
R1342:Slc8a3 UTSW 12 81316016 missense probably damaging 0.99
R1437:Slc8a3 UTSW 12 81315986 missense probably damaging 0.99
R1470:Slc8a3 UTSW 12 81199710 missense probably benign
R1470:Slc8a3 UTSW 12 81199710 missense probably benign
R1557:Slc8a3 UTSW 12 81315557 missense probably damaging 1.00
R1563:Slc8a3 UTSW 12 81205007 missense possibly damaging 0.47
R1918:Slc8a3 UTSW 12 81314844 missense probably damaging 0.99
R1930:Slc8a3 UTSW 12 81314446 missense probably damaging 1.00
R1931:Slc8a3 UTSW 12 81314446 missense probably damaging 1.00
R2232:Slc8a3 UTSW 12 81315220 missense probably damaging 0.99
R2680:Slc8a3 UTSW 12 81202339 missense probably damaging 0.99
R2941:Slc8a3 UTSW 12 81315179 missense probably damaging 1.00
R3157:Slc8a3 UTSW 12 81314992 missense probably damaging 1.00
R3159:Slc8a3 UTSW 12 81314992 missense probably damaging 1.00
R3751:Slc8a3 UTSW 12 81204138 missense probably damaging 1.00
R3859:Slc8a3 UTSW 12 81314872 missense probably damaging 0.99
R4240:Slc8a3 UTSW 12 81315176 missense probably damaging 0.99
R4527:Slc8a3 UTSW 12 81315853 missense probably damaging 1.00
R4547:Slc8a3 UTSW 12 81314851 missense possibly damaging 0.76
R4951:Slc8a3 UTSW 12 81314699 missense probably benign 0.31
R4951:Slc8a3 UTSW 12 81315986 missense probably damaging 0.99
R5022:Slc8a3 UTSW 12 81199558 missense probably damaging 0.96
R5049:Slc8a3 UTSW 12 81214132 missense probably damaging 1.00
R5057:Slc8a3 UTSW 12 81199558 missense probably damaging 0.96
R5104:Slc8a3 UTSW 12 81214134 missense probably null 0.34
R5122:Slc8a3 UTSW 12 81314258 critical splice donor site probably null
R5183:Slc8a3 UTSW 12 81314491 missense possibly damaging 0.79
R5629:Slc8a3 UTSW 12 81199631 missense probably damaging 1.00
R6062:Slc8a3 UTSW 12 81314350 missense probably damaging 1.00
R6218:Slc8a3 UTSW 12 81199567 missense probably benign
R6279:Slc8a3 UTSW 12 81314978 missense probably damaging 0.99
R6300:Slc8a3 UTSW 12 81314978 missense probably damaging 0.99
R6416:Slc8a3 UTSW 12 81315627 missense probably damaging 1.00
R6790:Slc8a3 UTSW 12 81314432 missense probably benign 0.00
R6999:Slc8a3 UTSW 12 81314755 missense probably benign 0.06
R7195:Slc8a3 UTSW 12 81314273 missense possibly damaging 0.95
R7268:Slc8a3 UTSW 12 81315053 missense probably damaging 0.98
R7288:Slc8a3 UTSW 12 81216824 missense possibly damaging 0.70
R7383:Slc8a3 UTSW 12 81315805 missense probably damaging 1.00
R7392:Slc8a3 UTSW 12 81314803 missense probably damaging 0.99
R7394:Slc8a3 UTSW 12 81214058 splice site probably null
R7549:Slc8a3 UTSW 12 81314770 missense probably benign 0.06
R7657:Slc8a3 UTSW 12 81314384 missense probably damaging 1.00
R7699:Slc8a3 UTSW 12 81314473 missense probably damaging 1.00
R7759:Slc8a3 UTSW 12 81314551 missense probably benign
R7960:Slc8a3 UTSW 12 81216732 missense probably benign 0.00
R7985:Slc8a3 UTSW 12 81314993 missense probably damaging 1.00
R8059:Slc8a3 UTSW 12 81202258 missense probably damaging 1.00
R8397:Slc8a3 UTSW 12 81199768 missense probably benign 0.45
R8413:Slc8a3 UTSW 12 81314678 missense probably damaging 0.97
R8681:Slc8a3 UTSW 12 81315140 missense probably benign
X0026:Slc8a3 UTSW 12 81315287 missense probably benign 0.22
X0028:Slc8a3 UTSW 12 81314943 missense probably damaging 1.00
Z1177:Slc8a3 UTSW 12 81314700 missense possibly damaging 0.92
Z1177:Slc8a3 UTSW 12 81315876 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TTGATGTAGCAGTAGGCCTCC -3'
(R):5'- AAAGGATGCTCATAAGGCCC -3'

Sequencing Primer
(F):5'- CCTCCAGCGTGGCAAATAGTATG -3'
(R):5'- TTTGCCAGCAAAGCCGC -3'
Posted On2020-07-13