Mutagenetix > Incidental Mutation

Incidental Mutation 'R8192:Slc8a3'

635247

Institutional Source

Beutler Lab

Gene Symbol

Slc8a3

Ensembl Gene

ENSMUSG00000079055

Gene Name

solute carrier family 8 (sodium/calcium exchanger), member 3

Synonyms

Ncx3

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8192 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

81197915-81333180 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 81199681 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 866 (V866D)

Ref Sequence

ENSEMBL: ENSMUSP00000138735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208] [ENSMUST00000182366]

AlphaFold

S4R2P9

Predicted Effect

SMART Domains

Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: V865D

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	754	919	2e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000085238
AA Change: V859D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: V859D

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.54e-43	SMART
low complexity region	705	716	N/A	INTRINSIC
Pfam:Na_Ca_ex	747	912	1.9e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000182208
AA Change: V866D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: V866D

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	89	248	8.1e-38	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	764	917	9.1e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000182366

SMART Domains

Protein: ENSMUSP00000138803
Gene: ENSMUSG00000079055

Domain	Start	End	E-Value	Type
PDB:2LT9\|A	1	52	2e-28	PDB
low complexity region	82	93	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam34	A	T	8: 43,650,933	D558E	probably damaging	Het
Alox15	T	A	11: 70,350,910	E48D	probably benign	Het
Alyref	T	C	11: 120,597,696	E102G	probably benign	Het
Bach2	A	G	4: 32,562,294	S254G	probably benign	Het
BC080695	T	G	4: 143,571,960	Y158D	probably benign	Het
Bcl2l13	A	G	6: 120,876,306	E184G	possibly damaging	Het
Best1	T	A	19: 9,986,300	I506F	possibly damaging	Het
Cd177	T	A	7: 24,754,302	D388V	probably benign	Het
Cep350	T	C	1: 155,940,783	K329E	possibly damaging	Het
Clasrp	T	C	7: 19,595,462	N65S	possibly damaging	Het
Cobl	T	C	11: 12,249,745	R1301G	probably benign	Het
Cul9	T	C	17: 46,538,347	E624G	probably benign	Het
Cyp21a1	A	T	17: 34,803,659	Y109N	probably damaging	Het
Dbf4	A	G	5: 8,398,134	S359P	probably benign	Het
Ddx60	A	G	8: 61,977,968	T846A	probably damaging	Het
Dnah11	A	G	12: 118,012,446	V2746A	probably benign	Het
Dnah12	G	A	14: 26,706,881	A221T	probably benign	Het
Dnajb8	C	T	6: 88,222,958	R159C	possibly damaging	Het
Dock2	A	G	11: 34,732,339		probably null	Het
Dpy19l1	T	C	9: 24,450,727	I119V	possibly damaging	Het
Dsg1c	A	G	18: 20,266,198	T120A	probably damaging	Het
Dzank1	T	C	2: 144,490,225	H397R	probably benign	Het
Fam35a	A	T	14: 34,245,216	S680T	probably benign	Het
Gaa	G	T	11: 119,270,409	A93S	possibly damaging	Het
Galnt4	G	A	10: 99,109,256	R281H	probably benign	Het
Gm13103	G	A	4: 143,851,539	W123*	probably null	Het
Gm3250	T	C	10: 77,782,457	E29G	unknown	Het
Gm5065	T	A	7: 5,359,596	D75E	possibly damaging	Het
H13	T	G	2: 152,669,602	D7E	probably benign	Het
H60c	T	A	10: 3,259,781	I140F	probably benign	Het
Hsd3b2	T	C	3: 98,713,592	N49S	probably benign	Het
Klhl11	G	T	11: 100,464,096	P300T	probably benign	Het
Knop1	C	A	7: 118,853,146	V117L		Het
Lrrc38	G	A	4: 143,350,733	G189R	probably damaging	Het
Lrrc9	A	T	12: 72,449,389	I13F	probably damaging	Het
Macf1	A	G	4: 123,440,597	S4456P	probably damaging	Het
Mkrn1	A	T	6: 39,399,355	V439D	probably damaging	Het
Muc2	T	A	7: 141,751,478	V612D		Het
Nrxn3	A	G	12: 90,204,795	N967D	probably benign	Het
Olfr1173	A	C	2: 88,274,944	V35G	probably damaging	Het
Olfr978	T	A	9: 39,994,171	D120E	probably damaging	Het
Oprm1	C	T	10: 6,838,417	P391S	probably benign	Het
Parp14	T	A	16: 35,871,214	E47V	probably benign	Het
Pikfyve	A	G	1: 65,246,395	E931G	possibly damaging	Het
Plcz1	A	T	6: 140,023,260	C151S	probably damaging	Het
Rbm26	A	G	14: 105,142,689		probably null	Het
Rffl	G	T	11: 82,812,723		probably null	Het
Sc5d	T	C	9: 42,259,798	I32V	probably benign	Het
Scube1	A	G	15: 83,629,382		probably null	Het
Slc12a6	A	G	2: 112,351,377	Y714C	probably damaging	Het
Slc26a3	A	G	12: 31,468,542	I670V	probably benign	Het
Slco3a1	A	T	7: 74,320,590	M423K	probably benign	Het
Smc6	A	G	12: 11,299,335	E773G	probably benign	Het
Son	A	G	16: 91,655,549	T395A	possibly damaging	Het
Ss18l1	T	C	2: 180,059,362	S290P	probably damaging	Het
Tcof1	A	C	18: 60,843,303	V78G	probably damaging	Het
Thsd1	G	A	8: 22,243,902	V322M	probably benign	Het
Tln2	A	T	9: 67,346,529	C753*	probably null	Het
Trav6n-6	T	A	14: 53,133,040	F83I	probably damaging	Het
Ttc39d	A	G	17: 80,216,578	H222R	probably damaging	Het
Ugt2b35	T	A	5: 87,001,443	S184R	probably damaging	Het
Upf1	A	G	8: 70,340,644	L288P	probably benign	Het
Zfp442	T	C	2: 150,408,709	I424M	unknown	Het
Zfp580	T	C	7: 5,053,115	V100A	probably benign	Het
Zfpm1	C	A	8: 122,332,094	P151Q	probably damaging	Het
Zfr2	C	T	10: 81,242,815	P294S	possibly damaging	Het

Other mutations in Slc8a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Slc8a3	APN	12	81314569	missense	probably benign
IGL01315:Slc8a3	APN	12	81314395	missense	probably damaging	0.97
IGL01365:Slc8a3	APN	12	81315376	missense	probably damaging	0.99
IGL01610:Slc8a3	APN	12	81315802	missense	probably damaging	1.00
IGL02227:Slc8a3	APN	12	81315683	missense	probably damaging	1.00
IGL02299:Slc8a3	APN	12	81315224	missense	probably damaging	0.98
IGL02548:Slc8a3	APN	12	81204156	splice site	probably benign
IGL02646:Slc8a3	APN	12	81315094	missense	probably damaging	1.00
IGL03135:Slc8a3	APN	12	81202249	missense	probably damaging	1.00
R0050:Slc8a3	UTSW	12	81315265	missense	probably damaging	1.00
R0627:Slc8a3	UTSW	12	81314842	missense	probably damaging	1.00
R0648:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1342:Slc8a3	UTSW	12	81316016	missense	probably damaging	0.99
R1437:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1557:Slc8a3	UTSW	12	81315557	missense	probably damaging	1.00
R1563:Slc8a3	UTSW	12	81205007	missense	possibly damaging	0.47
R1918:Slc8a3	UTSW	12	81314844	missense	probably damaging	0.99
R1930:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1931:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R2232:Slc8a3	UTSW	12	81315220	missense	probably damaging	0.99
R2680:Slc8a3	UTSW	12	81202339	missense	probably damaging	0.99
R2941:Slc8a3	UTSW	12	81315179	missense	probably damaging	1.00
R3157:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3159:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3751:Slc8a3	UTSW	12	81204138	missense	probably damaging	1.00
R3859:Slc8a3	UTSW	12	81314872	missense	probably damaging	0.99
R4240:Slc8a3	UTSW	12	81315176	missense	probably damaging	0.99
R4527:Slc8a3	UTSW	12	81315853	missense	probably damaging	1.00
R4547:Slc8a3	UTSW	12	81314851	missense	possibly damaging	0.76
R4951:Slc8a3	UTSW	12	81314699	missense	probably benign	0.31
R4951:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R5022:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5049:Slc8a3	UTSW	12	81214132	missense	probably damaging	1.00
R5057:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5104:Slc8a3	UTSW	12	81214134	missense	probably null	0.34
R5122:Slc8a3	UTSW	12	81314258	critical splice donor site	probably null
R5183:Slc8a3	UTSW	12	81314491	missense	possibly damaging	0.79
R5629:Slc8a3	UTSW	12	81199631	missense	probably damaging	1.00
R6062:Slc8a3	UTSW	12	81314350	missense	probably damaging	1.00
R6218:Slc8a3	UTSW	12	81199567	missense	probably benign
R6279:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6300:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6416:Slc8a3	UTSW	12	81315627	missense	probably damaging	1.00
R6790:Slc8a3	UTSW	12	81314432	missense	probably benign	0.00
R6999:Slc8a3	UTSW	12	81314755	missense	probably benign	0.06
R7195:Slc8a3	UTSW	12	81314273	missense	possibly damaging	0.95
R7268:Slc8a3	UTSW	12	81315053	missense	probably damaging	0.98
R7288:Slc8a3	UTSW	12	81216824	missense	possibly damaging	0.70
R7383:Slc8a3	UTSW	12	81315805	missense	probably damaging	1.00
R7392:Slc8a3	UTSW	12	81314803	missense	probably damaging	0.99
R7394:Slc8a3	UTSW	12	81214058	splice site	probably null
R7549:Slc8a3	UTSW	12	81314770	missense	probably benign	0.06
R7657:Slc8a3	UTSW	12	81314384	missense	probably damaging	1.00
R7699:Slc8a3	UTSW	12	81314473	missense	probably damaging	1.00
R7759:Slc8a3	UTSW	12	81314551	missense	probably benign
R7960:Slc8a3	UTSW	12	81216732	missense	probably benign	0.00
R7985:Slc8a3	UTSW	12	81314993	missense	probably damaging	1.00
R8059:Slc8a3	UTSW	12	81202258	missense	probably damaging	1.00
R8397:Slc8a3	UTSW	12	81199768	missense	probably benign	0.45
R8413:Slc8a3	UTSW	12	81314678	missense	probably damaging	0.97
R8681:Slc8a3	UTSW	12	81315140	missense	probably benign
R9060:Slc8a3	UTSW	12	81214078	missense	probably benign	0.45
R9061:Slc8a3	UTSW	12	81216766	missense	probably damaging	0.99
R9267:Slc8a3	UTSW	12	81314434	missense	possibly damaging	0.77
R9416:Slc8a3	UTSW	12	81315064	missense	probably benign	0.06
R9519:Slc8a3	UTSW	12	81315552	missense	probably benign	0.30
R9531:Slc8a3	UTSW	12	81315223	missense	probably damaging	1.00
X0026:Slc8a3	UTSW	12	81315287	missense	probably benign	0.22
X0028:Slc8a3	UTSW	12	81314943	missense	probably damaging	1.00
Z1177:Slc8a3	UTSW	12	81314700	missense	possibly damaging	0.92
Z1177:Slc8a3	UTSW	12	81315876	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- TTGATGTAGCAGTAGGCCTCC -3'
(R):5'- AAAGGATGCTCATAAGGCCC -3'

Sequencing Primer
(F):5'- CCTCCAGCGTGGCAAATAGTATG -3'
(R):5'- TTTGCCAGCAAAGCCGC -3'

Posted On

2020-07-13