Incidental Mutation 'R8192:Dnah12'
ID 635250
Institutional Source Beutler Lab
Gene Symbol Dnah12
Ensembl Gene ENSMUSG00000021879
Gene Name dynein, axonemal, heavy chain 12
Synonyms HL19, DHC3, Dnahc7l, 4921531P07Rik, HL-19, LOC380889, Hdhc3, Dnahc12, DLP12
MMRRC Submission 067615-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.187) question?
Stock # R8192 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 26414429-26613660 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 26428036 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 221 (A221T)
Ref Sequence ENSEMBL: ENSMUSP00000022433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022433]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000022433
AA Change: A221T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879
AA Change: A221T

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
coiled coil region 588 666 N/A INTRINSIC
Pfam:DHC_N2 676 1113 1.1e-147 PFAM
AAA 1268 1407 1.15e0 SMART
Pfam:AAA_5 1552 1695 1.5e-7 PFAM
Blast:AAA 1709 1827 2e-24 BLAST
Blast:AAA 1848 1898 1e-16 BLAST
AAA 1903 2051 5.42e-4 SMART
Pfam:AAA_8 2238 2316 2e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 A T 8: 44,103,970 (GRCm39) D558E probably damaging Het
Alox15 T A 11: 70,241,736 (GRCm39) E48D probably benign Het
Alyref T C 11: 120,488,522 (GRCm39) E102G probably benign Het
Bach2 A G 4: 32,562,294 (GRCm39) S254G probably benign Het
Bcl2l13 A G 6: 120,853,267 (GRCm39) E184G possibly damaging Het
Best1 T A 19: 9,963,664 (GRCm39) I506F possibly damaging Het
Cd177 T A 7: 24,453,727 (GRCm39) D388V probably benign Het
Cep350 T C 1: 155,816,529 (GRCm39) K329E possibly damaging Het
Clasrp T C 7: 19,329,387 (GRCm39) N65S possibly damaging Het
Cobl T C 11: 12,199,745 (GRCm39) R1301G probably benign Het
Cul9 T C 17: 46,849,273 (GRCm39) E624G probably benign Het
Cyp21a1 A T 17: 35,022,633 (GRCm39) Y109N probably damaging Het
Dbf4 A G 5: 8,448,134 (GRCm39) S359P probably benign Het
Ddx60 A G 8: 62,431,002 (GRCm39) T846A probably damaging Het
Dnah11 A G 12: 117,976,181 (GRCm39) V2746A probably benign Het
Dnajb8 C T 6: 88,199,940 (GRCm39) R159C possibly damaging Het
Dock2 A G 11: 34,623,166 (GRCm39) probably null Het
Dpy19l1 T C 9: 24,362,023 (GRCm39) I119V possibly damaging Het
Dsg1c A G 18: 20,399,255 (GRCm39) T120A probably damaging Het
Dzank1 T C 2: 144,332,145 (GRCm39) H397R probably benign Het
Gaa G T 11: 119,161,235 (GRCm39) A93S possibly damaging Het
Galnt4 G A 10: 98,945,118 (GRCm39) R281H probably benign Het
Gm3250 T C 10: 77,618,291 (GRCm39) E29G unknown Het
H13 T G 2: 152,511,522 (GRCm39) D7E probably benign Het
H60c T A 10: 3,209,781 (GRCm39) I140F probably benign Het
Hsd3b2 T C 3: 98,620,908 (GRCm39) N49S probably benign Het
Klhl11 G T 11: 100,354,922 (GRCm39) P300T probably benign Het
Knop1 C A 7: 118,452,369 (GRCm39) V117L Het
Lgalsl2 T A 7: 5,362,595 (GRCm39) D75E possibly damaging Het
Lrrc38 G A 4: 143,077,303 (GRCm39) G189R probably damaging Het
Lrrc9 A T 12: 72,496,163 (GRCm39) I13F probably damaging Het
Macf1 A G 4: 123,334,390 (GRCm39) S4456P probably damaging Het
Mkrn1 A T 6: 39,376,289 (GRCm39) V439D probably damaging Het
Muc2 T A 7: 141,305,215 (GRCm39) V612D Het
Nrxn3 A G 12: 90,171,569 (GRCm39) N967D probably benign Het
Oprm1 C T 10: 6,788,417 (GRCm39) P391S probably benign Het
Or10g7 T A 9: 39,905,467 (GRCm39) D120E probably damaging Het
Or5d43 A C 2: 88,105,288 (GRCm39) V35G probably damaging Het
Parp14 T A 16: 35,691,584 (GRCm39) E47V probably benign Het
Pikfyve A G 1: 65,285,554 (GRCm39) E931G possibly damaging Het
Plcz1 A T 6: 139,968,986 (GRCm39) C151S probably damaging Het
Pramel20 T G 4: 143,298,530 (GRCm39) Y158D probably benign Het
Pramel27 G A 4: 143,578,109 (GRCm39) W123* probably null Het
Rbm26 A G 14: 105,380,125 (GRCm39) probably null Het
Rffl G T 11: 82,703,549 (GRCm39) probably null Het
Sc5d T C 9: 42,171,094 (GRCm39) I32V probably benign Het
Scube1 A G 15: 83,513,583 (GRCm39) probably null Het
Shld2 A T 14: 33,967,173 (GRCm39) S680T probably benign Het
Slc12a6 A G 2: 112,181,722 (GRCm39) Y714C probably damaging Het
Slc26a3 A G 12: 31,518,541 (GRCm39) I670V probably benign Het
Slc8a3 A T 12: 81,246,455 (GRCm39) V866D probably damaging Het
Slco3a1 A T 7: 73,970,338 (GRCm39) M423K probably benign Het
Smc6 A G 12: 11,349,336 (GRCm39) E773G probably benign Het
Son A G 16: 91,452,437 (GRCm39) T395A possibly damaging Het
Ss18l1 T C 2: 179,701,155 (GRCm39) S290P probably damaging Het
Tcof1 A C 18: 60,976,375 (GRCm39) V78G probably damaging Het
Thsd1 G A 8: 22,733,918 (GRCm39) V322M probably benign Het
Tln2 A T 9: 67,253,811 (GRCm39) C753* probably null Het
Trav6n-6 T A 14: 53,370,497 (GRCm39) F83I probably damaging Het
Ttc39d A G 17: 80,524,007 (GRCm39) H222R probably damaging Het
Ugt2b35 T A 5: 87,149,302 (GRCm39) S184R probably damaging Het
Upf1 A G 8: 70,793,294 (GRCm39) L288P probably benign Het
Zfp442 T C 2: 150,250,629 (GRCm39) I424M unknown Het
Zfp580 T C 7: 5,056,114 (GRCm39) V100A probably benign Het
Zfpm1 C A 8: 123,058,833 (GRCm39) P151Q probably damaging Het
Zfr2 C T 10: 81,078,649 (GRCm39) P294S possibly damaging Het
Other mutations in Dnah12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Dnah12 APN 14 26,492,962 (GRCm39) missense probably damaging 1.00
IGL01602:Dnah12 APN 14 26,431,430 (GRCm39) splice site probably benign
IGL01681:Dnah12 APN 14 26,443,315 (GRCm39) missense probably benign
IGL02082:Dnah12 APN 14 26,428,317 (GRCm39) missense possibly damaging 0.79
IGL02140:Dnah12 APN 14 26,437,732 (GRCm39) missense probably benign 0.20
IGL02170:Dnah12 APN 14 26,495,069 (GRCm39) missense probably damaging 0.99
IGL02174:Dnah12 APN 14 26,428,072 (GRCm39) missense probably benign 0.00
IGL02367:Dnah12 APN 14 26,430,316 (GRCm39) missense probably benign 0.30
IGL02418:Dnah12 APN 14 26,495,679 (GRCm39) missense probably damaging 1.00
IGL03039:Dnah12 APN 14 26,445,667 (GRCm39) missense probably benign 0.02
IGL03066:Dnah12 APN 14 26,418,553 (GRCm39) missense probably benign 0.06
drippings UTSW 14 26,576,761 (GRCm39) missense probably damaging 1.00
grueben UTSW 14 26,600,036 (GRCm39) missense probably damaging 1.00
BB010:Dnah12 UTSW 14 26,488,072 (GRCm39) missense probably benign 0.00
BB020:Dnah12 UTSW 14 26,488,072 (GRCm39) missense probably benign 0.00
F5770:Dnah12 UTSW 14 26,495,050 (GRCm39) missense possibly damaging 0.95
FR4304:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
FR4340:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
FR4342:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
FR4589:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
IGL03055:Dnah12 UTSW 14 26,594,697 (GRCm39) missense probably damaging 1.00
LCD18:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
R0003:Dnah12 UTSW 14 26,494,601 (GRCm39) missense probably damaging 1.00
R0110:Dnah12 UTSW 14 26,520,856 (GRCm39) missense probably damaging 1.00
R0302:Dnah12 UTSW 14 26,521,956 (GRCm39) missense probably damaging 1.00
R0355:Dnah12 UTSW 14 26,427,272 (GRCm39) splice site probably null
R0364:Dnah12 UTSW 14 26,445,628 (GRCm39) missense probably benign 0.10
R0469:Dnah12 UTSW 14 26,520,856 (GRCm39) missense probably damaging 1.00
R0558:Dnah12 UTSW 14 26,430,465 (GRCm39) missense probably benign 0.00
R0709:Dnah12 UTSW 14 26,606,222 (GRCm39) splice site probably benign
R0734:Dnah12 UTSW 14 26,521,970 (GRCm39) missense probably benign 0.00
R1273:Dnah12 UTSW 14 26,460,375 (GRCm39) nonsense probably null
R1496:Dnah12 UTSW 14 26,431,403 (GRCm39) missense probably benign
R1503:Dnah12 UTSW 14 26,495,649 (GRCm39) missense probably damaging 1.00
R1535:Dnah12 UTSW 14 26,538,279 (GRCm39) missense possibly damaging 0.91
R1608:Dnah12 UTSW 14 26,488,147 (GRCm39) missense probably damaging 1.00
R1682:Dnah12 UTSW 14 26,500,840 (GRCm39) missense possibly damaging 0.71
R1758:Dnah12 UTSW 14 26,488,071 (GRCm39) missense probably benign 0.02
R1826:Dnah12 UTSW 14 26,432,174 (GRCm39) missense probably benign 0.01
R1829:Dnah12 UTSW 14 26,522,032 (GRCm39) missense probably damaging 1.00
R1829:Dnah12 UTSW 14 26,494,980 (GRCm39) missense probably damaging 1.00
R1862:Dnah12 UTSW 14 26,430,412 (GRCm39) missense probably benign 0.30
R1862:Dnah12 UTSW 14 26,418,553 (GRCm39) missense probably benign 0.06
R1913:Dnah12 UTSW 14 26,514,221 (GRCm39) splice site probably null
R1933:Dnah12 UTSW 14 26,455,650 (GRCm39) missense probably damaging 0.98
R2006:Dnah12 UTSW 14 26,536,416 (GRCm39) missense possibly damaging 0.95
R2045:Dnah12 UTSW 14 26,503,485 (GRCm39) missense probably null 1.00
R2113:Dnah12 UTSW 14 26,488,098 (GRCm39) missense probably damaging 1.00
R2125:Dnah12 UTSW 14 26,445,613 (GRCm39) nonsense probably null
R2126:Dnah12 UTSW 14 26,445,613 (GRCm39) nonsense probably null
R2207:Dnah12 UTSW 14 26,503,744 (GRCm39) missense probably damaging 0.99
R2213:Dnah12 UTSW 14 26,460,485 (GRCm39) missense probably benign 0.06
R2511:Dnah12 UTSW 14 26,491,907 (GRCm39) missense possibly damaging 0.65
R2875:Dnah12 UTSW 14 26,598,907 (GRCm39) missense probably benign 0.05
R2875:Dnah12 UTSW 14 26,414,625 (GRCm39) missense probably benign 0.04
R3551:Dnah12 UTSW 14 26,492,929 (GRCm39) missense probably benign 0.01
R3713:Dnah12 UTSW 14 26,534,747 (GRCm39) missense probably benign
R3729:Dnah12 UTSW 14 26,427,220 (GRCm39) missense probably benign 0.02
R3799:Dnah12 UTSW 14 26,492,880 (GRCm39) missense probably damaging 1.00
R3846:Dnah12 UTSW 14 26,431,366 (GRCm39) missense probably benign 0.00
R3892:Dnah12 UTSW 14 26,578,573 (GRCm39) missense probably benign 0.03
R3921:Dnah12 UTSW 14 26,493,008 (GRCm39) missense probably damaging 1.00
R3940:Dnah12 UTSW 14 26,444,754 (GRCm39) missense probably benign
R4065:Dnah12 UTSW 14 26,492,405 (GRCm39) missense probably benign 0.02
R4113:Dnah12 UTSW 14 26,414,722 (GRCm39) missense probably damaging 0.98
R4249:Dnah12 UTSW 14 26,430,341 (GRCm39) missense possibly damaging 0.70
R4259:Dnah12 UTSW 14 26,520,883 (GRCm39) missense probably benign 0.01
R4260:Dnah12 UTSW 14 26,520,883 (GRCm39) missense probably benign 0.01
R4348:Dnah12 UTSW 14 26,536,498 (GRCm39) missense possibly damaging 0.94
R4457:Dnah12 UTSW 14 26,537,464 (GRCm39) missense probably damaging 1.00
R4490:Dnah12 UTSW 14 26,455,758 (GRCm39) missense possibly damaging 0.67
R4491:Dnah12 UTSW 14 26,455,758 (GRCm39) missense possibly damaging 0.67
R4494:Dnah12 UTSW 14 26,593,812 (GRCm39) missense probably damaging 0.99
R4523:Dnah12 UTSW 14 26,598,915 (GRCm39) missense possibly damaging 0.83
R4523:Dnah12 UTSW 14 26,491,979 (GRCm39) missense probably damaging 0.97
R4546:Dnah12 UTSW 14 26,494,971 (GRCm39) missense probably damaging 1.00
R4584:Dnah12 UTSW 14 26,494,551 (GRCm39) missense probably damaging 1.00
R4624:Dnah12 UTSW 14 26,456,913 (GRCm39) missense possibly damaging 0.82
R4689:Dnah12 UTSW 14 26,427,994 (GRCm39) missense probably benign 0.00
R4727:Dnah12 UTSW 14 26,594,274 (GRCm39) missense probably damaging 1.00
R4732:Dnah12 UTSW 14 26,503,741 (GRCm39) missense probably damaging 1.00
R4733:Dnah12 UTSW 14 26,503,741 (GRCm39) missense probably damaging 1.00
R4851:Dnah12 UTSW 14 26,437,784 (GRCm39) nonsense probably null
R4879:Dnah12 UTSW 14 26,439,201 (GRCm39) critical splice donor site probably null
R4893:Dnah12 UTSW 14 26,431,325 (GRCm39) missense possibly damaging 0.66
R4915:Dnah12 UTSW 14 26,455,725 (GRCm39) missense probably damaging 1.00
R4927:Dnah12 UTSW 14 26,583,762 (GRCm39) nonsense probably null
R4939:Dnah12 UTSW 14 26,613,481 (GRCm39) missense probably damaging 1.00
R4962:Dnah12 UTSW 14 26,437,855 (GRCm39) missense probably benign 0.00
R5011:Dnah12 UTSW 14 26,431,326 (GRCm39) missense probably benign 0.03
R5013:Dnah12 UTSW 14 26,431,326 (GRCm39) missense probably benign 0.03
R5043:Dnah12 UTSW 14 26,606,147 (GRCm39) missense probably damaging 1.00
R5049:Dnah12 UTSW 14 26,456,852 (GRCm39) missense probably benign 0.09
R5122:Dnah12 UTSW 14 26,439,155 (GRCm39) missense probably benign 0.00
R5135:Dnah12 UTSW 14 26,492,434 (GRCm39) missense probably damaging 0.99
R5149:Dnah12 UTSW 14 26,572,883 (GRCm39) nonsense probably null
R5154:Dnah12 UTSW 14 26,571,320 (GRCm39) missense probably benign 0.12
R5206:Dnah12 UTSW 14 26,491,942 (GRCm39) missense probably damaging 1.00
R5307:Dnah12 UTSW 14 26,414,641 (GRCm39) missense possibly damaging 0.49
R5330:Dnah12 UTSW 14 26,495,787 (GRCm39) missense probably damaging 1.00
R5335:Dnah12 UTSW 14 26,601,695 (GRCm39) missense probably damaging 1.00
R5339:Dnah12 UTSW 14 26,536,494 (GRCm39) missense possibly damaging 0.83
R5354:Dnah12 UTSW 14 26,496,299 (GRCm39) splice site probably null
R5389:Dnah12 UTSW 14 26,456,904 (GRCm39) missense probably damaging 1.00
R5434:Dnah12 UTSW 14 26,581,256 (GRCm39) missense probably damaging 1.00
R5466:Dnah12 UTSW 14 26,493,007 (GRCm39) missense probably damaging 1.00
R5655:Dnah12 UTSW 14 26,431,424 (GRCm39) missense probably benign 0.01
R5681:Dnah12 UTSW 14 26,537,452 (GRCm39) missense probably benign 0.32
R5824:Dnah12 UTSW 14 26,492,475 (GRCm39) critical splice donor site probably null
R5863:Dnah12 UTSW 14 26,576,878 (GRCm39) missense probably damaging 1.00
R5890:Dnah12 UTSW 14 26,428,039 (GRCm39) missense probably benign 0.09
R5912:Dnah12 UTSW 14 26,491,965 (GRCm39) nonsense probably null
R5916:Dnah12 UTSW 14 26,428,073 (GRCm39) missense possibly damaging 0.92
R5941:Dnah12 UTSW 14 26,428,022 (GRCm39) missense probably benign 0.00
R5987:Dnah12 UTSW 14 26,608,828 (GRCm39) missense possibly damaging 0.54
R5992:Dnah12 UTSW 14 26,418,496 (GRCm39) missense probably benign 0.04
R6132:Dnah12 UTSW 14 26,439,066 (GRCm39) missense probably damaging 1.00
R6136:Dnah12 UTSW 14 26,597,227 (GRCm39) missense probably damaging 0.99
R6158:Dnah12 UTSW 14 26,495,642 (GRCm39) missense possibly damaging 0.95
R6183:Dnah12 UTSW 14 26,583,726 (GRCm39) missense probably damaging 1.00
R6191:Dnah12 UTSW 14 26,431,412 (GRCm39) missense probably benign 0.03
R6235:Dnah12 UTSW 14 26,576,761 (GRCm39) missense probably damaging 1.00
R6277:Dnah12 UTSW 14 26,492,439 (GRCm39) missense probably damaging 1.00
R6332:Dnah12 UTSW 14 26,439,129 (GRCm39) missense probably damaging 0.99
R6334:Dnah12 UTSW 14 26,427,989 (GRCm39) missense possibly damaging 0.51
R6443:Dnah12 UTSW 14 26,600,008 (GRCm39) missense probably benign 0.06
R6480:Dnah12 UTSW 14 26,594,412 (GRCm39) missense probably damaging 1.00
R6530:Dnah12 UTSW 14 26,456,865 (GRCm39) missense probably damaging 1.00
R6678:Dnah12 UTSW 14 26,456,847 (GRCm39) missense probably damaging 1.00
R6709:Dnah12 UTSW 14 26,594,706 (GRCm39) missense probably damaging 1.00
R6724:Dnah12 UTSW 14 26,518,180 (GRCm39) missense probably benign 0.02
R6745:Dnah12 UTSW 14 26,428,383 (GRCm39) missense probably damaging 0.99
R6788:Dnah12 UTSW 14 26,523,470 (GRCm39) missense probably damaging 0.99
R6894:Dnah12 UTSW 14 26,456,904 (GRCm39) missense probably damaging 1.00
R6912:Dnah12 UTSW 14 26,600,036 (GRCm39) missense probably damaging 1.00
R6982:Dnah12 UTSW 14 26,521,033 (GRCm39) splice site probably null
R7001:Dnah12 UTSW 14 26,601,681 (GRCm39) missense probably damaging 0.99
R7002:Dnah12 UTSW 14 26,598,955 (GRCm39) missense probably damaging 1.00
R7017:Dnah12 UTSW 14 26,456,835 (GRCm39) missense probably benign
R7107:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7108:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7121:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7122:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7135:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7135:Dnah12 UTSW 14 26,523,370 (GRCm39) missense probably damaging 0.99
R7150:Dnah12 UTSW 14 26,583,689 (GRCm39) missense probably damaging 0.99
R7188:Dnah12 UTSW 14 26,536,370 (GRCm39) missense probably benign 0.04
R7201:Dnah12 UTSW 14 26,536,579 (GRCm39) missense probably benign 0.08
R7202:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7204:Dnah12 UTSW 14 26,503,442 (GRCm39) missense probably damaging 0.99
R7204:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7205:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7206:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7219:Dnah12 UTSW 14 26,576,837 (GRCm39) missense probably damaging 0.99
R7337:Dnah12 UTSW 14 26,488,534 (GRCm39) splice site probably null
R7339:Dnah12 UTSW 14 26,594,277 (GRCm39) missense probably benign
R7363:Dnah12 UTSW 14 26,445,766 (GRCm39) missense probably benign
R7426:Dnah12 UTSW 14 26,445,781 (GRCm39) missense probably benign 0.01
R7472:Dnah12 UTSW 14 26,578,592 (GRCm39) missense probably benign 0.01
R7579:Dnah12 UTSW 14 26,492,460 (GRCm39) missense probably benign 0.05
R7655:Dnah12 UTSW 14 26,581,273 (GRCm39) missense probably benign 0.21
R7656:Dnah12 UTSW 14 26,581,273 (GRCm39) missense probably benign 0.21
R7694:Dnah12 UTSW 14 26,503,337 (GRCm39) missense probably damaging 1.00
R7730:Dnah12 UTSW 14 26,507,890 (GRCm39) missense probably damaging 1.00
R7837:Dnah12 UTSW 14 26,518,176 (GRCm39) missense probably benign 0.01
R7855:Dnah12 UTSW 14 26,551,286 (GRCm39) missense probably benign 0.14
R7870:Dnah12 UTSW 14 26,578,486 (GRCm39) missense probably benign 0.00
R7920:Dnah12 UTSW 14 26,578,499 (GRCm39) missense possibly damaging 0.58
R7933:Dnah12 UTSW 14 26,488,072 (GRCm39) missense probably benign 0.00
R7956:Dnah12 UTSW 14 26,430,427 (GRCm39) missense probably damaging 0.96
R8263:Dnah12 UTSW 14 26,613,421 (GRCm39) missense noncoding transcript
R8287:Dnah12 UTSW 14 26,534,560 (GRCm39) missense probably benign
R8336:Dnah12 UTSW 14 26,432,220 (GRCm39) missense probably benign 0.01
R8362:Dnah12 UTSW 14 26,576,788 (GRCm39) missense probably damaging 1.00
R8392:Dnah12 UTSW 14 26,607,869 (GRCm39) missense probably benign
R8458:Dnah12 UTSW 14 26,548,849 (GRCm39) critical splice acceptor site probably null
R8481:Dnah12 UTSW 14 26,575,753 (GRCm39) missense probably benign 0.02
R8551:Dnah12 UTSW 14 26,496,227 (GRCm39) missense probably damaging 0.97
R8669:Dnah12 UTSW 14 26,552,582 (GRCm39) splice site probably benign
R8698:Dnah12 UTSW 14 26,428,418 (GRCm39) missense probably benign 0.02
R8709:Dnah12 UTSW 14 26,414,757 (GRCm39) missense probably benign 0.00
R8778:Dnah12 UTSW 14 26,455,718 (GRCm39) missense probably benign 0.29
R9049:Dnah12 UTSW 14 26,443,275 (GRCm39) missense probably benign 0.00
R9087:Dnah12 UTSW 14 26,546,503 (GRCm39) missense probably damaging 1.00
R9099:Dnah12 UTSW 14 26,492,325 (GRCm39) missense probably benign 0.31
R9153:Dnah12 UTSW 14 26,536,569 (GRCm39) missense probably damaging 1.00
R9177:Dnah12 UTSW 14 26,571,255 (GRCm39) missense possibly damaging 0.84
R9214:Dnah12 UTSW 14 26,445,060 (GRCm39) missense probably benign 0.02
R9268:Dnah12 UTSW 14 26,571,255 (GRCm39) missense possibly damaging 0.84
R9274:Dnah12 UTSW 14 26,537,374 (GRCm39) missense probably benign 0.00
R9293:Dnah12 UTSW 14 26,495,016 (GRCm39) missense probably benign
R9322:Dnah12 UTSW 14 26,492,934 (GRCm39) missense possibly damaging 0.75
R9353:Dnah12 UTSW 14 26,578,507 (GRCm39) missense probably damaging 1.00
R9506:Dnah12 UTSW 14 26,514,168 (GRCm39) missense probably benign 0.00
R9518:Dnah12 UTSW 14 26,495,713 (GRCm39) missense probably damaging 1.00
R9524:Dnah12 UTSW 14 26,572,494 (GRCm39) missense probably null 0.91
R9562:Dnah12 UTSW 14 26,597,281 (GRCm39) missense possibly damaging 0.58
R9565:Dnah12 UTSW 14 26,597,281 (GRCm39) missense possibly damaging 0.58
R9573:Dnah12 UTSW 14 26,414,619 (GRCm39) missense probably benign
R9581:Dnah12 UTSW 14 26,491,985 (GRCm39) missense probably damaging 1.00
R9689:Dnah12 UTSW 14 26,590,871 (GRCm39) missense probably null 1.00
R9727:Dnah12 UTSW 14 26,523,510 (GRCm39) nonsense probably null
V7580:Dnah12 UTSW 14 26,495,050 (GRCm39) missense possibly damaging 0.95
V7581:Dnah12 UTSW 14 26,495,050 (GRCm39) missense possibly damaging 0.95
X0018:Dnah12 UTSW 14 26,536,437 (GRCm39) missense probably damaging 1.00
X0027:Dnah12 UTSW 14 26,538,245 (GRCm39) missense probably damaging 1.00
X0065:Dnah12 UTSW 14 26,536,602 (GRCm39) missense possibly damaging 0.93
Z1177:Dnah12 UTSW 14 26,597,172 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTACGCCATTTCAACCC -3'
(R):5'- CTTCACAATCAATTGGGCCTCTAG -3'

Sequencing Primer
(F):5'- TCAACCCTGTTTAATGTGATGC -3'
(R):5'- GGCCTCTAGCTCTATTGATGAAC -3'
Posted On 2020-07-13