Incidental Mutation 'R8192:Rbm26'
ID635253
Institutional Source Beutler Lab
Gene Symbol Rbm26
Ensembl Gene ENSMUSG00000022119
Gene NameRNA binding motif protein 26
Synonyms1700009P03Rik, Pro1777, C230097K14Rik
MMRRC Submission
Accession Numbers

Genbank: NM_134077; MGI: 1921463

Is this an essential gene? Possibly essential (E-score: 0.611) question?
Stock #R8192 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location105106751-105177327 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 105142689 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022715] [ENSMUST00000100327] [ENSMUST00000163499] [ENSMUST00000163545]
Predicted Effect probably null
Transcript: ENSMUST00000022715
SMART Domains Protein: ENSMUSP00000022715
Gene: ENSMUSG00000022119

DomainStartEndE-ValueType
Pfam:PWI 10 80 1.1e-9 PFAM
low complexity region 102 123 N/A INTRINSIC
low complexity region 131 186 N/A INTRINSIC
low complexity region 190 215 N/A INTRINSIC
ZnF_C3H1 289 315 2.61e-4 SMART
low complexity region 330 389 N/A INTRINSIC
low complexity region 394 409 N/A INTRINSIC
RRM 533 602 7.74e-3 SMART
low complexity region 722 735 N/A INTRINSIC
Blast:RRM_2 753 820 6e-19 BLAST
low complexity region 848 879 N/A INTRINSIC
RRM 892 956 2.1e-1 SMART
low complexity region 970 1002 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100327
SMART Domains Protein: ENSMUSP00000097901
Gene: ENSMUSG00000022119

DomainStartEndE-ValueType
Pfam:PWI 10 80 6.1e-10 PFAM
low complexity region 102 123 N/A INTRINSIC
low complexity region 131 186 N/A INTRINSIC
low complexity region 190 215 N/A INTRINSIC
ZnF_C3H1 289 315 2.61e-4 SMART
low complexity region 330 389 N/A INTRINSIC
low complexity region 394 409 N/A INTRINSIC
RRM 533 602 7.74e-3 SMART
low complexity region 698 711 N/A INTRINSIC
Blast:RRM_2 729 796 6e-19 BLAST
low complexity region 824 855 N/A INTRINSIC
RRM 868 932 2.1e-1 SMART
low complexity region 946 978 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163499
SMART Domains Protein: ENSMUSP00000128197
Gene: ENSMUSG00000022119

DomainStartEndE-ValueType
Pfam:PWI 10 80 6.2e-10 PFAM
low complexity region 102 123 N/A INTRINSIC
low complexity region 131 186 N/A INTRINSIC
low complexity region 190 215 N/A INTRINSIC
ZnF_C3H1 289 315 2.61e-4 SMART
low complexity region 330 389 N/A INTRINSIC
low complexity region 394 409 N/A INTRINSIC
RRM 538 607 7.74e-3 SMART
low complexity region 727 740 N/A INTRINSIC
Blast:RRM_2 758 825 6e-19 BLAST
low complexity region 853 884 N/A INTRINSIC
RRM 897 961 2.1e-1 SMART
low complexity region 975 983 N/A INTRINSIC
low complexity region 986 1001 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163545
SMART Domains Protein: ENSMUSP00000126414
Gene: ENSMUSG00000022119

DomainStartEndE-ValueType
Pfam:PWI 11 81 1.5e-11 PFAM
low complexity region 102 123 N/A INTRINSIC
low complexity region 131 186 N/A INTRINSIC
low complexity region 190 215 N/A INTRINSIC
ZnF_C3H1 289 315 2.61e-4 SMART
low complexity region 330 389 N/A INTRINSIC
low complexity region 394 409 N/A INTRINSIC
RRM 538 607 7.74e-3 SMART
low complexity region 724 737 N/A INTRINSIC
Blast:RRM_2 755 822 6e-19 BLAST
low complexity region 850 881 N/A INTRINSIC
RRM 894 958 2.1e-1 SMART
low complexity region 972 1004 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (64/64)
Allele List at MGI

All alleles(33) : Gene trapped(33)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 A T 8: 43,650,933 D558E probably damaging Het
Alox15 T A 11: 70,350,910 E48D probably benign Het
Alyref T C 11: 120,597,696 E102G probably benign Het
Bach2 A G 4: 32,562,294 S254G probably benign Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bcl2l13 A G 6: 120,876,306 E184G possibly damaging Het
Best1 T A 19: 9,986,300 I506F possibly damaging Het
Cd177 T A 7: 24,754,302 D388V probably benign Het
Cep350 T C 1: 155,940,783 K329E possibly damaging Het
Clasrp T C 7: 19,595,462 N65S possibly damaging Het
Cobl T C 11: 12,249,745 R1301G probably benign Het
Cul9 T C 17: 46,538,347 E624G probably benign Het
Cyp21a1 A T 17: 34,803,659 Y109N probably damaging Het
Dbf4 A G 5: 8,398,134 S359P probably benign Het
Ddx60 A G 8: 61,977,968 T846A probably damaging Het
Dnah11 A G 12: 118,012,446 V2746A probably benign Het
Dnah12 G A 14: 26,706,881 A221T probably benign Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Dock2 A G 11: 34,732,339 probably null Het
Dpy19l1 T C 9: 24,450,727 I119V possibly damaging Het
Dsg1c A G 18: 20,266,198 T120A probably damaging Het
Dzank1 T C 2: 144,490,225 H397R probably benign Het
Fam35a A T 14: 34,245,216 S680T probably benign Het
Gaa G T 11: 119,270,409 A93S possibly damaging Het
Galnt4 G A 10: 99,109,256 R281H probably benign Het
Gm13103 G A 4: 143,851,539 W123* probably null Het
Gm3250 T C 10: 77,782,457 E29G unknown Het
Gm5065 T A 7: 5,359,596 D75E possibly damaging Het
H13 T G 2: 152,669,602 D7E probably benign Het
H60c T A 10: 3,259,781 I140F probably benign Het
Hsd3b2 T C 3: 98,713,592 N49S probably benign Het
Klhl11 G T 11: 100,464,096 P300T probably benign Het
Knop1 C A 7: 118,853,146 V117L Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Lrrc9 A T 12: 72,449,389 I13F probably damaging Het
Macf1 A G 4: 123,440,597 S4456P probably damaging Het
Mkrn1 A T 6: 39,399,355 V439D probably damaging Het
Muc2 T A 7: 141,751,478 V612D Het
Nrxn3 A G 12: 90,204,795 N967D probably benign Het
Olfr1173 A C 2: 88,274,944 V35G probably damaging Het
Olfr978 T A 9: 39,994,171 D120E probably damaging Het
Oprm1 C T 10: 6,838,417 P391S probably benign Het
Parp14 T A 16: 35,871,214 E47V probably benign Het
Pikfyve A G 1: 65,246,395 E931G possibly damaging Het
Plcz1 A T 6: 140,023,260 C151S probably damaging Het
Rffl G T 11: 82,812,723 probably null Het
Sc5d T C 9: 42,259,798 I32V probably benign Het
Scube1 A G 15: 83,629,382 probably null Het
Slc12a6 A G 2: 112,351,377 Y714C probably damaging Het
Slc26a3 A G 12: 31,468,542 I670V probably benign Het
Slc8a3 A T 12: 81,199,681 V866D probably damaging Het
Slco3a1 A T 7: 74,320,590 M423K probably benign Het
Smc6 A G 12: 11,299,335 E773G probably benign Het
Son A G 16: 91,655,549 T395A possibly damaging Het
Ss18l1 T C 2: 180,059,362 S290P probably damaging Het
Tcof1 A C 18: 60,843,303 V78G probably damaging Het
Thsd1 G A 8: 22,243,902 V322M probably benign Het
Tln2 A T 9: 67,346,529 C753* probably null Het
Trav6n-6 T A 14: 53,133,040 F83I probably damaging Het
Ttc39d A G 17: 80,216,578 H222R probably damaging Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Upf1 A G 8: 70,340,644 L288P probably benign Het
Zfp442 T C 2: 150,408,709 I424M unknown Het
Zfp580 T C 7: 5,053,115 V100A probably benign Het
Zfpm1 C A 8: 122,332,094 P151Q probably damaging Het
Zfr2 C T 10: 81,242,815 P294S possibly damaging Het
Other mutations in Rbm26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Rbm26 APN 14 105159960 missense unknown
IGL00948:Rbm26 APN 14 105150343 missense probably damaging 1.00
IGL01584:Rbm26 APN 14 105131532 missense probably damaging 0.99
IGL01726:Rbm26 APN 14 105152507 missense probably damaging 0.99
IGL02095:Rbm26 APN 14 105144260 missense probably damaging 1.00
IGL03306:Rbm26 APN 14 105151322 missense probably damaging 0.99
monte UTSW 14 105142834 missense probably benign 0.12
D4043:Rbm26 UTSW 14 105152540 missense possibly damaging 0.59
I0000:Rbm26 UTSW 14 105153567 missense unknown
R0051:Rbm26 UTSW 14 105152540 missense possibly damaging 0.95
R0051:Rbm26 UTSW 14 105152540 missense possibly damaging 0.95
R0243:Rbm26 UTSW 14 105131938 missense probably benign 0.22
R0738:Rbm26 UTSW 14 105176782 missense unknown
R1566:Rbm26 UTSW 14 105160544 missense unknown
R1645:Rbm26 UTSW 14 105150817 missense probably damaging 1.00
R1789:Rbm26 UTSW 14 105117073 missense probably benign 0.32
R1809:Rbm26 UTSW 14 105117106 splice site probably benign
R2144:Rbm26 UTSW 14 105115202 nonsense probably null
R2321:Rbm26 UTSW 14 105153427 missense unknown
R2495:Rbm26 UTSW 14 105151312 splice site probably benign
R2906:Rbm26 UTSW 14 105142834 missense probably benign 0.12
R2907:Rbm26 UTSW 14 105142834 missense probably benign 0.12
R2908:Rbm26 UTSW 14 105142834 missense probably benign 0.12
R3034:Rbm26 UTSW 14 105153445 missense unknown
R3427:Rbm26 UTSW 14 105131532 missense probably damaging 0.99
R3818:Rbm26 UTSW 14 105141270 missense probably damaging 0.99
R3863:Rbm26 UTSW 14 105121068 missense probably damaging 0.99
R4448:Rbm26 UTSW 14 105151550 missense probably damaging 0.99
R5022:Rbm26 UTSW 14 105144252 missense probably damaging 1.00
R5040:Rbm26 UTSW 14 105121016 missense probably benign 0.05
R5626:Rbm26 UTSW 14 105144231 missense probably benign 0.43
R5817:Rbm26 UTSW 14 105128603 missense probably damaging 1.00
R5960:Rbm26 UTSW 14 105150315 missense probably damaging 1.00
R6318:Rbm26 UTSW 14 105131535 missense probably damaging 0.99
R6608:Rbm26 UTSW 14 105152498 missense probably damaging 1.00
R6821:Rbm26 UTSW 14 105116964 intron probably benign
R7075:Rbm26 UTSW 14 105160607 missense unknown
R7136:Rbm26 UTSW 14 105144267 missense possibly damaging 0.88
R7340:Rbm26 UTSW 14 105152540 missense possibly damaging 0.86
R7431:Rbm26 UTSW 14 105117092 missense possibly damaging 0.71
R7554:Rbm26 UTSW 14 105160593 missense unknown
R7638:Rbm26 UTSW 14 105150848 missense probably damaging 1.00
RF004:Rbm26 UTSW 14 105151495 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAACGCAATGTCCAACTTCC -3'
(R):5'- ACTAGTACTTCCAGTTTTGGGGAG -3'

Sequencing Primer
(F):5'- GCAATGTCCAACTTCCCAATCTTTG -3'
(R):5'- ATCGACTTGGTTTTTGTTTACAGACC -3'
Posted On2020-07-13