Incidental Mutation 'R8193:Or4c105'
ID 635271
Institutional Source Beutler Lab
Gene Symbol Or4c105
Ensembl Gene ENSMUSG00000064084
Gene Name olfactory receptor family 4 subfamily C member 105
Synonyms Olfr1202, GA_x6K02T2Q125-50290367-50291296, MOR232-7
MMRRC Submission 067616-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R8193 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 88643145-88648446 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 88647803 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 96 (M96K)
Ref Sequence ENSEMBL: ENSMUSP00000071935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072057]
AlphaFold Q8VF98
Predicted Effect probably damaging
Transcript: ENSMUST00000072057
AA Change: M96K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000071935
Gene: ENSMUSG00000064084
AA Change: M96K

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 6.8e-47 PFAM
Pfam:7tm_1 39 285 1.2e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,213,517 (GRCm39) V48E possibly damaging Het
4930522H14Rik A G 4: 109,381,529 (GRCm39) L83S probably benign Het
Abhd18 C A 3: 40,884,660 (GRCm39) T233K probably benign Het
Adam26a A T 8: 44,022,273 (GRCm39) C406S probably damaging Het
Anp32e G A 3: 95,836,710 (GRCm39) probably benign Het
Cd33 C T 7: 43,181,696 (GRCm39) A155T possibly damaging Het
Cdc25c A T 18: 34,882,675 (GRCm39) probably null Het
Cep350 A G 1: 155,737,825 (GRCm39) S2673P probably benign Het
Chodl T C 16: 78,738,412 (GRCm39) S127P probably damaging Het
Clstn2 A G 9: 97,465,683 (GRCm39) S103P probably damaging Het
Crocc2 T A 1: 93,117,888 (GRCm39) probably null Het
Cyp24a1 A G 2: 170,327,622 (GRCm39) L507P probably damaging Het
Dcbld2 T A 16: 58,284,373 (GRCm39) probably null Het
Dnah14 T C 1: 181,515,770 (GRCm39) Y1991H probably damaging Het
Dnajb8 C T 6: 88,199,940 (GRCm39) R159C possibly damaging Het
Edrf1 C T 7: 133,263,606 (GRCm39) T971I possibly damaging Het
Ermap A G 4: 119,041,140 (GRCm39) I290T possibly damaging Het
Eva1a A T 6: 82,068,921 (GRCm39) S83C probably benign Het
Fcgbp A T 7: 27,804,276 (GRCm39) N1795Y probably damaging Het
Foxg1 A G 12: 49,432,377 (GRCm39) H370R possibly damaging Het
Gabra1 A G 11: 42,037,968 (GRCm39) Y217H probably damaging Het
Gm3086 A G 12: 70,016,264 (GRCm39) N62S noncoding transcript Het
Hmcn1 A T 1: 150,453,228 (GRCm39) Y5362* probably null Het
Igkv5-37 C A 6: 69,940,796 (GRCm39) probably benign Het
Ints3 A G 3: 90,307,929 (GRCm39) V647A possibly damaging Het
Itga1 A G 13: 115,104,991 (GRCm39) probably null Het
Limk2 T C 11: 3,297,691 (GRCm39) K481E possibly damaging Het
Lonp2 G T 8: 87,358,091 (GRCm39) G104V probably damaging Het
Lpar5 T C 6: 125,058,302 (GRCm39) S8P probably benign Het
Map2k7 T C 8: 4,294,059 (GRCm39) F202L probably benign Het
Mark1 T G 1: 184,660,249 (GRCm39) M136L probably damaging Het
Myo15b T C 11: 115,775,973 (GRCm39) S590P probably damaging Het
Nbas T C 12: 13,483,010 (GRCm39) V1429A probably damaging Het
Nbeal1 T A 1: 60,292,640 (GRCm39) Y1097* probably null Het
Ncf4 T C 15: 78,146,466 (GRCm39) S299P probably damaging Het
Nfkbiz T C 16: 55,642,214 (GRCm39) D68G probably damaging Het
Nomo1 T C 7: 45,692,037 (GRCm39) S154P possibly damaging Het
Nrp1 G T 8: 129,187,187 (GRCm39) W411L probably damaging Het
Or10d1b T C 9: 39,613,498 (GRCm39) D189G possibly damaging Het
Or5t18 T G 2: 86,637,209 (GRCm39) I45L noncoding transcript Het
Or8g2b T C 9: 39,750,757 (GRCm39) I9T probably benign Het
Or9g4b T C 2: 85,616,305 (GRCm39) V150A probably benign Het
Pcsk5 A G 19: 17,563,415 (GRCm39) V574A possibly damaging Het
Prex1 C A 2: 166,435,780 (GRCm39) R589L possibly damaging Het
Prl7d1 A G 13: 27,893,230 (GRCm39) V227A Het
Prpf40b T A 15: 99,201,949 (GRCm39) F16I unknown Het
Rasa2 G A 9: 96,484,791 (GRCm39) P141L probably damaging Het
Rtl1 A G 12: 109,558,650 (GRCm39) V1063A probably benign Het
Sema4d A T 13: 51,859,192 (GRCm39) C512* probably null Het
Slc19a2 A G 1: 164,084,794 (GRCm39) N228S probably benign Het
Tcf4 A T 18: 69,633,994 (GRCm39) probably benign Het
Tnks2 T C 19: 36,832,353 (GRCm39) V264A possibly damaging Het
Ugt2b35 T A 5: 87,149,302 (GRCm39) S184R probably damaging Het
Usp53 T C 3: 122,741,012 (GRCm39) E746G probably benign Het
Utp18 T C 11: 93,766,903 (GRCm39) D268G probably damaging Het
Vmn1r172 T A 7: 23,359,752 (GRCm39) Y212* probably null Het
Vmn2r100 T A 17: 19,725,102 (GRCm39) C10* probably null Het
Vmn2r113 G T 17: 23,164,501 (GRCm39) V135F probably benign Het
Vps54 T C 11: 21,242,045 (GRCm39) F387L probably benign Het
Xab2 A C 8: 3,663,389 (GRCm39) D450E probably benign Het
Zfp408 G T 2: 91,475,361 (GRCm39) R598S probably benign Het
Zfp788 T A 7: 41,298,038 (GRCm39) C225S probably benign Het
Zfp944 T A 17: 22,558,861 (GRCm39) K129* probably null Het
Other mutations in Or4c105
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03221:Or4c105 APN 2 88,647,781 (GRCm39) missense possibly damaging 0.54
R0105:Or4c105 UTSW 2 88,648,253 (GRCm39) missense probably damaging 1.00
R0699:Or4c105 UTSW 2 88,647,568 (GRCm39) missense probably damaging 1.00
R0709:Or4c105 UTSW 2 88,648,226 (GRCm39) missense probably benign 0.42
R1177:Or4c105 UTSW 2 88,647,704 (GRCm39) missense probably benign 0.06
R1436:Or4c105 UTSW 2 88,648,336 (GRCm39) missense possibly damaging 0.48
R1827:Or4c105 UTSW 2 88,648,402 (GRCm39) missense probably benign 0.04
R1828:Or4c105 UTSW 2 88,648,402 (GRCm39) missense probably benign 0.04
R1872:Or4c105 UTSW 2 88,648,280 (GRCm39) missense probably benign 0.02
R1878:Or4c105 UTSW 2 88,647,805 (GRCm39) missense probably benign 0.00
R4903:Or4c105 UTSW 2 88,648,342 (GRCm39) missense probably benign 0.14
R5035:Or4c105 UTSW 2 88,648,443 (GRCm39) missense probably benign 0.01
R6279:Or4c105 UTSW 2 88,647,719 (GRCm39) missense probably damaging 1.00
R7402:Or4c105 UTSW 2 88,647,687 (GRCm39) missense probably damaging 1.00
R7809:Or4c105 UTSW 2 88,647,902 (GRCm39) missense probably damaging 0.96
R8172:Or4c105 UTSW 2 88,647,986 (GRCm39) missense probably damaging 1.00
R8673:Or4c105 UTSW 2 88,647,590 (GRCm39) missense probably benign
R8730:Or4c105 UTSW 2 88,648,043 (GRCm39) missense possibly damaging 0.64
R9459:Or4c105 UTSW 2 88,647,967 (GRCm39) missense probably benign 0.12
R9772:Or4c105 UTSW 2 88,647,958 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCTCACACAGAATCTGCAC -3'
(R):5'- GGGCCACAGAAAGGTAATCC -3'

Sequencing Primer
(F):5'- CTCTGTGGTAGGAAATTTGCTC -3'
(R):5'- TTGTATACCTCCATGAAGAAAGCCTC -3'
Posted On 2020-07-13