Incidental Mutation 'R8193:Cyp24a1'
ID635274
Institutional Source Beutler Lab
Gene Symbol Cyp24a1
Ensembl Gene ENSMUSG00000038567
Gene Namecytochrome P450, family 24, subfamily a, polypeptide 1
SynonymsCP24, 24-OHase, Cyp24, 25-hydroxyvitamin D-24-hydroxylase
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R8193 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location170482708-170497145 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 170485702 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 507 (L507P)
Ref Sequence ENSEMBL: ENSMUSP00000047954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038824]
Predicted Effect probably damaging
Transcript: ENSMUST00000038824
AA Change: L507P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047954
Gene: ENSMUSG00000038567
AA Change: L507P

DomainStartEndE-ValueType
Pfam:p450 58 511 6e-108 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: The protein encoded by this gene localizes to the mitochondrion, where it degrades calcitriol to calcitetrol. This gene is upregulated by binding of calcitriol to the upstream regulatory region and to a downstream enhancer region, thereby allowing calcitriol to autoregulate its concentration in the cell. The encoded protein may also play a role in calcium homeostasis. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for disruption of this gene suffer a 50% mortality rate between birth and weaning. abnormalities are seen in the development of membranous bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,419,868 V48E possibly damaging Het
4930522H14Rik A G 4: 109,524,332 L83S probably benign Het
Abhd18 C A 3: 40,930,225 T233K probably benign Het
Adam26a A T 8: 43,569,236 C406S probably damaging Het
Anp32e G A 3: 95,929,398 probably benign Het
Cd33 C T 7: 43,532,272 A155T possibly damaging Het
Cdc25c A T 18: 34,749,622 probably null Het
Cep350 A G 1: 155,862,079 S2673P probably benign Het
Chodl T C 16: 78,941,524 S127P probably damaging Het
Clstn2 A G 9: 97,583,630 S103P probably damaging Het
Crocc2 T A 1: 93,190,166 probably null Het
Dcbld2 T A 16: 58,464,010 probably null Het
Dnah14 T C 1: 181,688,205 Y1991H probably damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Edrf1 C T 7: 133,661,877 T971I possibly damaging Het
Ermap A G 4: 119,183,943 I290T possibly damaging Het
Eva1a A T 6: 82,091,940 S83C probably benign Het
Fcgbp A T 7: 28,104,851 N1795Y probably damaging Het
Foxg1 A G 12: 49,385,594 H370R possibly damaging Het
Gabra1 A G 11: 42,147,141 Y217H probably damaging Het
Gm3086 A G 12: 69,969,490 N62S noncoding transcript Het
Hmcn1 A T 1: 150,577,477 Y5362* probably null Het
Igkv5-37 C A 6: 69,963,812 probably benign Het
Ints3 A G 3: 90,400,622 V647A possibly damaging Het
Itga1 A G 13: 114,968,455 probably null Het
Limk2 T C 11: 3,347,691 K481E possibly damaging Het
Lonp2 G T 8: 86,631,463 G104V probably damaging Het
Lpar5 T C 6: 125,081,339 S8P probably benign Het
Map2k7 T C 8: 4,244,059 F202L probably benign Het
Mark1 T G 1: 184,928,052 M136L probably damaging Het
Myo15b T C 11: 115,885,147 S590P probably damaging Het
Nbas T C 12: 13,433,009 V1429A probably damaging Het
Nbeal1 T A 1: 60,253,481 Y1097* probably null Het
Ncf4 T C 15: 78,262,266 S299P probably damaging Het
Nfkbiz T C 16: 55,821,851 D68G probably damaging Het
Nomo1 T C 7: 46,042,613 S154P possibly damaging Het
Nrp1 G T 8: 128,460,706 W411L probably damaging Het
Olfr1015 T C 2: 85,785,961 V150A probably benign Het
Olfr1202 T A 2: 88,817,459 M96K probably damaging Het
Olfr141 T G 2: 86,806,865 I45L noncoding transcript Het
Olfr149 T C 9: 39,702,202 D189G possibly damaging Het
Olfr971 T C 9: 39,839,461 I9T probably benign Het
Pcsk5 A G 19: 17,586,051 V574A possibly damaging Het
Prex1 C A 2: 166,593,860 R589L possibly damaging Het
Prl7d1 A G 13: 27,709,247 V227A Het
Prpf40b T A 15: 99,304,068 F16I unknown Het
Rasa2 G A 9: 96,602,738 P141L probably damaging Het
Rtl1 A G 12: 109,592,216 V1063A probably benign Het
Sema4d A T 13: 51,705,156 C512* probably null Het
Slc19a2 A G 1: 164,257,225 N228S probably benign Het
Tcf4 A T 18: 69,500,923 probably benign Het
Tnks2 T C 19: 36,854,953 V264A possibly damaging Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Usp53 T C 3: 122,947,363 E746G probably benign Het
Utp18 T C 11: 93,876,077 D268G probably damaging Het
Vmn1r172 T A 7: 23,660,327 Y212* probably null Het
Vmn2r100 T A 17: 19,504,840 C10* probably null Het
Vmn2r113 G T 17: 22,945,527 V135F probably benign Het
Vps54 T C 11: 21,292,045 F387L probably benign Het
Xab2 A C 8: 3,613,389 D450E probably benign Het
Zfp408 G T 2: 91,645,016 R598S probably benign Het
Zfp788 T A 7: 41,648,614 C225S probably benign Het
Zfp944 T A 17: 22,339,880 K129* probably null Het
Other mutations in Cyp24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Cyp24a1 APN 2 170496566 missense probably damaging 1.00
IGL02187:Cyp24a1 APN 2 170494093 missense probably damaging 1.00
IGL02269:Cyp24a1 APN 2 170496572 missense probably damaging 1.00
IGL02273:Cyp24a1 APN 2 170496358 missense probably damaging 1.00
IGL03089:Cyp24a1 APN 2 170485966 missense probably damaging 1.00
R0359:Cyp24a1 UTSW 2 170491699 missense possibly damaging 0.94
R1037:Cyp24a1 UTSW 2 170491617 missense probably damaging 1.00
R1243:Cyp24a1 UTSW 2 170495406 missense probably benign 0.28
R1601:Cyp24a1 UTSW 2 170485691 missense possibly damaging 0.48
R1696:Cyp24a1 UTSW 2 170486043 missense probably benign 0.10
R1839:Cyp24a1 UTSW 2 170496741 missense probably benign
R1845:Cyp24a1 UTSW 2 170487917 missense probably benign 0.06
R4832:Cyp24a1 UTSW 2 170496178 missense probably benign 0.07
R5649:Cyp24a1 UTSW 2 170496309 missense possibly damaging 0.87
R6320:Cyp24a1 UTSW 2 170486784 missense probably benign 0.13
R6668:Cyp24a1 UTSW 2 170485885 critical splice donor site probably null
R6823:Cyp24a1 UTSW 2 170487979 missense probably benign 0.12
R6953:Cyp24a1 UTSW 2 170487946 missense probably benign
R7136:Cyp24a1 UTSW 2 170494143 missense probably benign 0.15
R7287:Cyp24a1 UTSW 2 170485906 missense probably damaging 1.00
R7831:Cyp24a1 UTSW 2 170485940 missense probably damaging 1.00
R7893:Cyp24a1 UTSW 2 170496516 critical splice donor site probably null
R8206:Cyp24a1 UTSW 2 170491669 missense possibly damaging 0.83
R8296:Cyp24a1 UTSW 2 170490116 missense probably damaging 1.00
R8384:Cyp24a1 UTSW 2 170486769 critical splice donor site probably null
X0061:Cyp24a1 UTSW 2 170485990 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTTGAGTGACATACTTGAGCCC -3'
(R):5'- CTGGGTCTCTACAACCCCA -3'

Sequencing Primer
(F):5'- CAGGAGGAGGAGGAGGTG -3'
(R):5'- GGGTCTCTACAACCCCATCCTAAG -3'
Posted On2020-07-13