Incidental Mutation 'R8193:1700006A11Rik'
ID635279
Institutional Source Beutler Lab
Gene Symbol 1700006A11Rik
Ensembl Gene ENSMUSG00000027973
Gene NameRIKEN cDNA 1700006A11 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R8193 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location124400989-124426040 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 124419868 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 48 (V48E)
Ref Sequence ENSEMBL: ENSMUSP00000029598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029598] [ENSMUST00000198630]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029598
AA Change: V48E

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029598
Gene: ENSMUSG00000027973
AA Change: V48E

DomainStartEndE-ValueType
RhoGAP 78 251 3.63e-37 SMART
RhoGAP 377 543 3.19e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198630
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,524,332 L83S probably benign Het
Abhd18 C A 3: 40,930,225 T233K probably benign Het
Adam26a A T 8: 43,569,236 C406S probably damaging Het
Anp32e G A 3: 95,929,398 probably benign Het
Cd33 C T 7: 43,532,272 A155T possibly damaging Het
Cdc25c A T 18: 34,749,622 probably null Het
Cep350 A G 1: 155,862,079 S2673P probably benign Het
Chodl T C 16: 78,941,524 S127P probably damaging Het
Clstn2 A G 9: 97,583,630 S103P probably damaging Het
Crocc2 T A 1: 93,190,166 probably null Het
Cyp24a1 A G 2: 170,485,702 L507P probably damaging Het
Dcbld2 T A 16: 58,464,010 probably null Het
Dnah14 T C 1: 181,688,205 Y1991H probably damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Edrf1 C T 7: 133,661,877 T971I possibly damaging Het
Ermap A G 4: 119,183,943 I290T possibly damaging Het
Eva1a A T 6: 82,091,940 S83C probably benign Het
Fcgbp A T 7: 28,104,851 N1795Y probably damaging Het
Foxg1 A G 12: 49,385,594 H370R possibly damaging Het
Gabra1 A G 11: 42,147,141 Y217H probably damaging Het
Gm3086 A G 12: 69,969,490 N62S noncoding transcript Het
Hmcn1 A T 1: 150,577,477 Y5362* probably null Het
Igkv5-37 C A 6: 69,963,812 probably benign Het
Ints3 A G 3: 90,400,622 V647A possibly damaging Het
Itga1 A G 13: 114,968,455 probably null Het
Limk2 T C 11: 3,347,691 K481E possibly damaging Het
Lonp2 G T 8: 86,631,463 G104V probably damaging Het
Lpar5 T C 6: 125,081,339 S8P probably benign Het
Map2k7 T C 8: 4,244,059 F202L probably benign Het
Mark1 T G 1: 184,928,052 M136L probably damaging Het
Myo15b T C 11: 115,885,147 S590P probably damaging Het
Nbas T C 12: 13,433,009 V1429A probably damaging Het
Nbeal1 T A 1: 60,253,481 Y1097* probably null Het
Ncf4 T C 15: 78,262,266 S299P probably damaging Het
Nfkbiz T C 16: 55,821,851 D68G probably damaging Het
Nomo1 T C 7: 46,042,613 S154P possibly damaging Het
Nrp1 G T 8: 128,460,706 W411L probably damaging Het
Olfr1015 T C 2: 85,785,961 V150A probably benign Het
Olfr1202 T A 2: 88,817,459 M96K probably damaging Het
Olfr141 T G 2: 86,806,865 I45L noncoding transcript Het
Olfr149 T C 9: 39,702,202 D189G possibly damaging Het
Olfr971 T C 9: 39,839,461 I9T probably benign Het
Pcsk5 A G 19: 17,586,051 V574A possibly damaging Het
Prex1 C A 2: 166,593,860 R589L possibly damaging Het
Prl7d1 A G 13: 27,709,247 V227A Het
Prpf40b T A 15: 99,304,068 F16I unknown Het
Rasa2 G A 9: 96,602,738 P141L probably damaging Het
Rtl1 A G 12: 109,592,216 V1063A probably benign Het
Sema4d A T 13: 51,705,156 C512* probably null Het
Slc19a2 A G 1: 164,257,225 N228S probably benign Het
Tcf4 A T 18: 69,500,923 probably benign Het
Tnks2 T C 19: 36,854,953 V264A possibly damaging Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Usp53 T C 3: 122,947,363 E746G probably benign Het
Utp18 T C 11: 93,876,077 D268G probably damaging Het
Vmn1r172 T A 7: 23,660,327 Y212* probably null Het
Vmn2r100 T A 17: 19,504,840 C10* probably null Het
Vmn2r113 G T 17: 22,945,527 V135F probably benign Het
Vps54 T C 11: 21,292,045 F387L probably benign Het
Xab2 A C 8: 3,613,389 D450E probably benign Het
Zfp408 G T 2: 91,645,016 R598S probably benign Het
Zfp788 T A 7: 41,648,614 C225S probably benign Het
Zfp944 T A 17: 22,339,880 K129* probably null Het
Other mutations in 1700006A11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:1700006A11Rik APN 3 124401409 missense probably benign 0.30
IGL02552:1700006A11Rik APN 3 124414496 missense probably damaging 1.00
IGL03092:1700006A11Rik APN 3 124406470 missense probably damaging 1.00
R0094:1700006A11Rik UTSW 3 124409778 splice site probably benign
R0097:1700006A11Rik UTSW 3 124412480 missense probably benign 0.13
R0097:1700006A11Rik UTSW 3 124412480 missense probably benign 0.13
R0184:1700006A11Rik UTSW 3 124419250 missense probably damaging 1.00
R0361:1700006A11Rik UTSW 3 124413634 missense possibly damaging 0.69
R1542:1700006A11Rik UTSW 3 124414406 missense possibly damaging 0.95
R1549:1700006A11Rik UTSW 3 124416792 missense probably benign 0.00
R1779:1700006A11Rik UTSW 3 124406514 missense probably damaging 0.99
R1839:1700006A11Rik UTSW 3 124409720 missense probably damaging 0.99
R1986:1700006A11Rik UTSW 3 124419328 missense probably damaging 0.99
R2042:1700006A11Rik UTSW 3 124416728 splice site probably benign
R2149:1700006A11Rik UTSW 3 124409686 missense probably benign 0.33
R2258:1700006A11Rik UTSW 3 124413618 missense possibly damaging 0.84
R2291:1700006A11Rik UTSW 3 124413801 missense probably damaging 1.00
R2509:1700006A11Rik UTSW 3 124406453 missense probably benign 0.44
R4912:1700006A11Rik UTSW 3 124419856 missense possibly damaging 0.68
R5074:1700006A11Rik UTSW 3 124416833 missense probably benign 0.01
R5303:1700006A11Rik UTSW 3 124406350 missense probably damaging 1.00
R5307:1700006A11Rik UTSW 3 124406350 missense probably damaging 1.00
R5308:1700006A11Rik UTSW 3 124406350 missense probably damaging 1.00
R5796:1700006A11Rik UTSW 3 124421428 missense possibly damaging 0.66
R6018:1700006A11Rik UTSW 3 124416799 missense probably damaging 1.00
R6198:1700006A11Rik UTSW 3 124416850 splice site probably null
R6504:1700006A11Rik UTSW 3 124419920 missense probably benign
R7124:1700006A11Rik UTSW 3 124414393 missense probably benign 0.04
R7248:1700006A11Rik UTSW 3 124414310 critical splice donor site probably null
R7351:1700006A11Rik UTSW 3 124412510 missense probably damaging 1.00
R7709:1700006A11Rik UTSW 3 124407685 missense probably damaging 1.00
R7773:1700006A11Rik UTSW 3 124412531 missense probably benign 0.00
R8201:1700006A11Rik UTSW 3 124401397 missense probably benign 0.00
X0063:1700006A11Rik UTSW 3 124419862 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGAATAGCACTGTCTTATCTCCC -3'
(R):5'- GCCCCATCATTCTATGAATTGC -3'

Sequencing Primer
(F):5'- TCCTACTGATAGAAATGAACGGC -3'
(R):5'- TGCAACAGACATCTTATGCAATCAG -3'
Posted On2020-07-13