Incidental Mutation 'R8193:Cd33'
ID635290
Institutional Source Beutler Lab
Gene Symbol Cd33
Ensembl Gene ENSMUSG00000004609
Gene NameCD33 antigen
SynonymsSiglec-3, gp67
MMRRC Submission
Accession Numbers

Genbank: NM_001111058.1, NM_021293.3; Ensembl: ENSMUST00000004728, ENSMUST00000039861

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8193 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location43524216-43544428 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43532272 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 155 (A155T)
Ref Sequence ENSEMBL: ENSMUSP00000004728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004728] [ENSMUST00000039861] [ENSMUST00000205503]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004728
AA Change: A155T

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000004728
Gene: ENSMUSG00000004609
AA Change: A155T

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 26 139 2.58e-6 SMART
IG_like 148 232 2.66e1 SMART
transmembrane domain 242 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039861
AA Change: A155T

PolyPhen 2 Score 0.395 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000045458
Gene: ENSMUSG00000004609
AA Change: A155T

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 26 139 2.58e-6 SMART
IG_like 148 232 2.66e1 SMART
transmembrane domain 242 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205503
AA Change: A155T

PolyPhen 2 Score 0.395 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (62/63)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene show slight reductions in mean erythrocyte count and hematocrit and increased concentration of blood aspartate aminotransaminase. There is also a hyporesponsiveness to induced peritonitis and a weaker IL-6 response to LPS-induced systemic inflammation. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,419,868 V48E possibly damaging Het
4930522H14Rik A G 4: 109,524,332 L83S probably benign Het
Abhd18 C A 3: 40,930,225 T233K probably benign Het
Adam26a A T 8: 43,569,236 C406S probably damaging Het
Anp32e G A 3: 95,929,398 probably benign Het
Cdc25c A T 18: 34,749,622 probably null Het
Cep350 A G 1: 155,862,079 S2673P probably benign Het
Chodl T C 16: 78,941,524 S127P probably damaging Het
Clstn2 A G 9: 97,583,630 S103P probably damaging Het
Crocc2 T A 1: 93,190,166 probably null Het
Cyp24a1 A G 2: 170,485,702 L507P probably damaging Het
Dcbld2 T A 16: 58,464,010 probably null Het
Dnah14 T C 1: 181,688,205 Y1991H probably damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Edrf1 C T 7: 133,661,877 T971I possibly damaging Het
Ermap A G 4: 119,183,943 I290T possibly damaging Het
Eva1a A T 6: 82,091,940 S83C probably benign Het
Fcgbp A T 7: 28,104,851 N1795Y probably damaging Het
Foxg1 A G 12: 49,385,594 H370R possibly damaging Het
Gabra1 A G 11: 42,147,141 Y217H probably damaging Het
Gm3086 A G 12: 69,969,490 N62S noncoding transcript Het
Hmcn1 A T 1: 150,577,477 Y5362* probably null Het
Igkv5-37 C A 6: 69,963,812 probably benign Het
Ints3 A G 3: 90,400,622 V647A possibly damaging Het
Itga1 A G 13: 114,968,455 probably null Het
Limk2 T C 11: 3,347,691 K481E possibly damaging Het
Lonp2 G T 8: 86,631,463 G104V probably damaging Het
Lpar5 T C 6: 125,081,339 S8P probably benign Het
Map2k7 T C 8: 4,244,059 F202L probably benign Het
Mark1 T G 1: 184,928,052 M136L probably damaging Het
Myo15b T C 11: 115,885,147 S590P probably damaging Het
Nbas T C 12: 13,433,009 V1429A probably damaging Het
Nbeal1 T A 1: 60,253,481 Y1097* probably null Het
Ncf4 T C 15: 78,262,266 S299P probably damaging Het
Nfkbiz T C 16: 55,821,851 D68G probably damaging Het
Nomo1 T C 7: 46,042,613 S154P possibly damaging Het
Nrp1 G T 8: 128,460,706 W411L probably damaging Het
Olfr1015 T C 2: 85,785,961 V150A probably benign Het
Olfr1202 T A 2: 88,817,459 M96K probably damaging Het
Olfr141 T G 2: 86,806,865 I45L noncoding transcript Het
Olfr149 T C 9: 39,702,202 D189G possibly damaging Het
Olfr971 T C 9: 39,839,461 I9T probably benign Het
Pcsk5 A G 19: 17,586,051 V574A possibly damaging Het
Prex1 C A 2: 166,593,860 R589L possibly damaging Het
Prl7d1 A G 13: 27,709,247 V227A Het
Prpf40b T A 15: 99,304,068 F16I unknown Het
Rasa2 G A 9: 96,602,738 P141L probably damaging Het
Rtl1 A G 12: 109,592,216 V1063A probably benign Het
Sema4d A T 13: 51,705,156 C512* probably null Het
Slc19a2 A G 1: 164,257,225 N228S probably benign Het
Tcf4 A T 18: 69,500,923 probably benign Het
Tnks2 T C 19: 36,854,953 V264A possibly damaging Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Usp53 T C 3: 122,947,363 E746G probably benign Het
Utp18 T C 11: 93,876,077 D268G probably damaging Het
Vmn1r172 T A 7: 23,660,327 Y212* probably null Het
Vmn2r100 T A 17: 19,504,840 C10* probably null Het
Vmn2r113 G T 17: 22,945,527 V135F probably benign Het
Vps54 T C 11: 21,292,045 F387L probably benign Het
Xab2 A C 8: 3,613,389 D450E probably benign Het
Zfp408 G T 2: 91,645,016 R598S probably benign Het
Zfp788 T A 7: 41,648,614 C225S probably benign Het
Zfp944 T A 17: 22,339,880 K129* probably null Het
Other mutations in Cd33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Cd33 APN 7 43529558 intron probably benign
IGL01025:Cd33 APN 7 43532905 missense probably damaging 1.00
IGL01593:Cd33 APN 7 43530281 missense possibly damaging 0.91
IGL02080:Cd33 APN 7 43528850 utr 3 prime probably benign
IGL02519:Cd33 APN 7 43528729 utr 3 prime probably benign
IGL02626:Cd33 APN 7 43530312 splice site probably benign
1mM(1):Cd33 UTSW 7 43528793 utr 3 prime probably benign
R0751:Cd33 UTSW 7 43532121 missense probably damaging 1.00
R1513:Cd33 UTSW 7 43532194 missense probably damaging 1.00
R1542:Cd33 UTSW 7 43532106 missense probably damaging 1.00
R1752:Cd33 UTSW 7 43532298 missense probably benign 0.24
R1928:Cd33 UTSW 7 43529879 missense probably benign 0.41
R2045:Cd33 UTSW 7 43529892 missense probably benign 0.00
R2127:Cd33 UTSW 7 43530275 missense possibly damaging 0.72
R3433:Cd33 UTSW 7 43529907 missense probably benign 0.00
R4760:Cd33 UTSW 7 43529495 missense probably benign
R4810:Cd33 UTSW 7 43532710 missense probably damaging 0.99
R5387:Cd33 UTSW 7 43532053 nonsense probably null
R5611:Cd33 UTSW 7 43532118 missense probably damaging 0.97
R5796:Cd33 UTSW 7 43533056 critical splice donor site probably null
R8021:Cd33 UTSW 7 43528838 missense unknown
Predicted Primers PCR Primer
(F):5'- TGACACCTGCTCCAGAGAAG -3'
(R):5'- GATCCCTCACACAGATGCTG -3'

Sequencing Primer
(F):5'- TGCTCCAGAGAAGGTCACC -3'
(R):5'- TCACACAGATGCTGGGCTG -3'
Posted On2020-07-13