Incidental Mutation 'R8193:Olfr149'
ID635298
Institutional Source Beutler Lab
Gene Symbol Olfr149
Ensembl Gene ENSMUSG00000062121
Gene Nameolfactory receptor 149
SynonymsGA_x6K02T2PVTD-33400306-33399371, MOR224-8, M31
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R8193 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location39700518-39707117 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39702202 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 189 (D189G)
Ref Sequence ENSEMBL: ENSMUSP00000080686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082027]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082027
AA Change: D189G

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080686
Gene: ENSMUSG00000062121
AA Change: D189G

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.7e-48 PFAM
Pfam:7TM_GPCR_Srsx 33 223 3.8e-9 PFAM
Pfam:7tm_1 39 286 1.2e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,419,868 V48E possibly damaging Het
4930522H14Rik A G 4: 109,524,332 L83S probably benign Het
Abhd18 C A 3: 40,930,225 T233K probably benign Het
Adam26a A T 8: 43,569,236 C406S probably damaging Het
Anp32e G A 3: 95,929,398 probably benign Het
Cd33 C T 7: 43,532,272 A155T possibly damaging Het
Cdc25c A T 18: 34,749,622 probably null Het
Cep350 A G 1: 155,862,079 S2673P probably benign Het
Chodl T C 16: 78,941,524 S127P probably damaging Het
Clstn2 A G 9: 97,583,630 S103P probably damaging Het
Crocc2 T A 1: 93,190,166 probably null Het
Cyp24a1 A G 2: 170,485,702 L507P probably damaging Het
Dcbld2 T A 16: 58,464,010 probably null Het
Dnah14 T C 1: 181,688,205 Y1991H probably damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Edrf1 C T 7: 133,661,877 T971I possibly damaging Het
Ermap A G 4: 119,183,943 I290T possibly damaging Het
Eva1a A T 6: 82,091,940 S83C probably benign Het
Fcgbp A T 7: 28,104,851 N1795Y probably damaging Het
Foxg1 A G 12: 49,385,594 H370R possibly damaging Het
Gabra1 A G 11: 42,147,141 Y217H probably damaging Het
Gm3086 A G 12: 69,969,490 N62S noncoding transcript Het
Hmcn1 A T 1: 150,577,477 Y5362* probably null Het
Igkv5-37 C A 6: 69,963,812 probably benign Het
Ints3 A G 3: 90,400,622 V647A possibly damaging Het
Itga1 A G 13: 114,968,455 probably null Het
Limk2 T C 11: 3,347,691 K481E possibly damaging Het
Lonp2 G T 8: 86,631,463 G104V probably damaging Het
Lpar5 T C 6: 125,081,339 S8P probably benign Het
Map2k7 T C 8: 4,244,059 F202L probably benign Het
Mark1 T G 1: 184,928,052 M136L probably damaging Het
Myo15b T C 11: 115,885,147 S590P probably damaging Het
Nbas T C 12: 13,433,009 V1429A probably damaging Het
Nbeal1 T A 1: 60,253,481 Y1097* probably null Het
Ncf4 T C 15: 78,262,266 S299P probably damaging Het
Nfkbiz T C 16: 55,821,851 D68G probably damaging Het
Nomo1 T C 7: 46,042,613 S154P possibly damaging Het
Nrp1 G T 8: 128,460,706 W411L probably damaging Het
Olfr1015 T C 2: 85,785,961 V150A probably benign Het
Olfr1202 T A 2: 88,817,459 M96K probably damaging Het
Olfr141 T G 2: 86,806,865 I45L noncoding transcript Het
Olfr971 T C 9: 39,839,461 I9T probably benign Het
Pcsk5 A G 19: 17,586,051 V574A possibly damaging Het
Prex1 C A 2: 166,593,860 R589L possibly damaging Het
Prl7d1 A G 13: 27,709,247 V227A Het
Prpf40b T A 15: 99,304,068 F16I unknown Het
Rasa2 G A 9: 96,602,738 P141L probably damaging Het
Rtl1 A G 12: 109,592,216 V1063A probably benign Het
Sema4d A T 13: 51,705,156 C512* probably null Het
Slc19a2 A G 1: 164,257,225 N228S probably benign Het
Tcf4 A T 18: 69,500,923 probably benign Het
Tnks2 T C 19: 36,854,953 V264A possibly damaging Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Usp53 T C 3: 122,947,363 E746G probably benign Het
Utp18 T C 11: 93,876,077 D268G probably damaging Het
Vmn1r172 T A 7: 23,660,327 Y212* probably null Het
Vmn2r100 T A 17: 19,504,840 C10* probably null Het
Vmn2r113 G T 17: 22,945,527 V135F probably benign Het
Vps54 T C 11: 21,292,045 F387L probably benign Het
Xab2 A C 8: 3,613,389 D450E probably benign Het
Zfp408 G T 2: 91,645,016 R598S probably benign Het
Zfp788 T A 7: 41,648,614 C225S probably benign Het
Zfp944 T A 17: 22,339,880 K129* probably null Het
Other mutations in Olfr149
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:Olfr149 APN 9 39702253 missense probably damaging 1.00
IGL02707:Olfr149 APN 9 39702641 missense probably damaging 0.99
IGL02730:Olfr149 APN 9 39702238 missense probably damaging 1.00
IGL03375:Olfr149 APN 9 39702575 missense probably damaging 1.00
R0244:Olfr149 UTSW 9 39702173 missense probably damaging 0.97
R0358:Olfr149 UTSW 9 39702001 missense possibly damaging 0.95
R4179:Olfr149 UTSW 9 39702091 missense probably benign 0.30
R5120:Olfr149 UTSW 9 39702070 missense probably benign 0.00
R5185:Olfr149 UTSW 9 39701876 missense probably benign
R5818:Olfr149 UTSW 9 39702365 missense probably benign 0.01
R6029:Olfr149 UTSW 9 39702400 missense probably damaging 1.00
R6207:Olfr149 UTSW 9 39702310 missense probably benign 0.06
R6454:Olfr149 UTSW 9 39701834 makesense probably null
R7451:Olfr149 UTSW 9 39702127 missense probably damaging 0.99
R8263:Olfr149 UTSW 9 39702157 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CAGTAAAATGGGCACTGCAG -3'
(R):5'- CCTGTACACAGTGATGGCTTATG -3'

Sequencing Primer
(F):5'- CAGGTGGAGAAGGCTCTATGTC -3'
(R):5'- CTACGCTACTCAGTCATAATGAGTC -3'
Posted On2020-07-13