Incidental Mutation 'R8193:Vps54'
ID635303
Institutional Source Beutler Lab
Gene Symbol Vps54
Ensembl Gene ENSMUSG00000020128
Gene NameVPS54 GARP complex subunit
Synonyms5330404P15Rik, wr, mSLP8, Vps54l
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R8193 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location21239281-21321136 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21292045 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 387 (F387L)
Ref Sequence ENSEMBL: ENSMUSP00000006221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006221] [ENSMUST00000109578] [ENSMUST00000132017]
PDB Structure C-terminal domain of Vps54 subunit of the GARP complex [X-RAY DIFFRACTION]
Vps54 C-terminal domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000006221
AA Change: F387L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000006221
Gene: ENSMUSG00000020128
AA Change: F387L

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:DUF2450 198 364 2.1e-12 PFAM
Pfam:Vps54 736 868 3.3e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109578
AA Change: F375L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000105206
Gene: ENSMUSG00000020128
AA Change: F375L

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:DUF2450 186 352 2.3e-12 PFAM
Pfam:Vps54 723 857 1.6e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132017
SMART Domains Protein: ENSMUSP00000116739
Gene: ENSMUSG00000020128

DomainStartEndE-ValueType
Pfam:DUF2450 72 238 1.4e-12 PFAM
Pfam:Vps54 573 707 7.8e-64 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes for a protein that in yeast forms part of a trimeric vacuolar-protein-sorting complex that is required for retrograde transport of proteins from prevacuoles to the late Golgi compartment. As in yeast, mammalian Vps54 proteins contain a coiled-coil region and dileucine motifs. Alternative splicing results in multiple transcript variants encoding different isoforms [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show progressive ataxia, tremors, and limb paralysis with degeneration of motor nerve cells of brainstem and spinal cord and atrophy of skeletal muscle beginning about 3-weeks of age. Mutants are sterile and most die by 3-months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,419,868 V48E possibly damaging Het
4930522H14Rik A G 4: 109,524,332 L83S probably benign Het
Abhd18 C A 3: 40,930,225 T233K probably benign Het
Adam26a A T 8: 43,569,236 C406S probably damaging Het
Anp32e G A 3: 95,929,398 probably benign Het
Cd33 C T 7: 43,532,272 A155T possibly damaging Het
Cdc25c A T 18: 34,749,622 probably null Het
Cep350 A G 1: 155,862,079 S2673P probably benign Het
Chodl T C 16: 78,941,524 S127P probably damaging Het
Clstn2 A G 9: 97,583,630 S103P probably damaging Het
Crocc2 T A 1: 93,190,166 probably null Het
Cyp24a1 A G 2: 170,485,702 L507P probably damaging Het
Dcbld2 T A 16: 58,464,010 probably null Het
Dnah14 T C 1: 181,688,205 Y1991H probably damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Edrf1 C T 7: 133,661,877 T971I possibly damaging Het
Ermap A G 4: 119,183,943 I290T possibly damaging Het
Eva1a A T 6: 82,091,940 S83C probably benign Het
Fcgbp A T 7: 28,104,851 N1795Y probably damaging Het
Foxg1 A G 12: 49,385,594 H370R possibly damaging Het
Gabra1 A G 11: 42,147,141 Y217H probably damaging Het
Gm3086 A G 12: 69,969,490 N62S noncoding transcript Het
Hmcn1 A T 1: 150,577,477 Y5362* probably null Het
Igkv5-37 C A 6: 69,963,812 probably benign Het
Ints3 A G 3: 90,400,622 V647A possibly damaging Het
Itga1 A G 13: 114,968,455 probably null Het
Limk2 T C 11: 3,347,691 K481E possibly damaging Het
Lonp2 G T 8: 86,631,463 G104V probably damaging Het
Lpar5 T C 6: 125,081,339 S8P probably benign Het
Map2k7 T C 8: 4,244,059 F202L probably benign Het
Mark1 T G 1: 184,928,052 M136L probably damaging Het
Myo15b T C 11: 115,885,147 S590P probably damaging Het
Nbas T C 12: 13,433,009 V1429A probably damaging Het
Nbeal1 T A 1: 60,253,481 Y1097* probably null Het
Ncf4 T C 15: 78,262,266 S299P probably damaging Het
Nfkbiz T C 16: 55,821,851 D68G probably damaging Het
Nomo1 T C 7: 46,042,613 S154P possibly damaging Het
Nrp1 G T 8: 128,460,706 W411L probably damaging Het
Olfr1015 T C 2: 85,785,961 V150A probably benign Het
Olfr1202 T A 2: 88,817,459 M96K probably damaging Het
Olfr141 T G 2: 86,806,865 I45L noncoding transcript Het
Olfr149 T C 9: 39,702,202 D189G possibly damaging Het
Olfr971 T C 9: 39,839,461 I9T probably benign Het
Pcsk5 A G 19: 17,586,051 V574A possibly damaging Het
Prex1 C A 2: 166,593,860 R589L possibly damaging Het
Prl7d1 A G 13: 27,709,247 V227A Het
Prpf40b T A 15: 99,304,068 F16I unknown Het
Rasa2 G A 9: 96,602,738 P141L probably damaging Het
Rtl1 A G 12: 109,592,216 V1063A probably benign Het
Sema4d A T 13: 51,705,156 C512* probably null Het
Slc19a2 A G 1: 164,257,225 N228S probably benign Het
Tcf4 A T 18: 69,500,923 probably benign Het
Tnks2 T C 19: 36,854,953 V264A possibly damaging Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Usp53 T C 3: 122,947,363 E746G probably benign Het
Utp18 T C 11: 93,876,077 D268G probably damaging Het
Vmn1r172 T A 7: 23,660,327 Y212* probably null Het
Vmn2r100 T A 17: 19,504,840 C10* probably null Het
Vmn2r113 G T 17: 22,945,527 V135F probably benign Het
Xab2 A C 8: 3,613,389 D450E probably benign Het
Zfp408 G T 2: 91,645,016 R598S probably benign Het
Zfp788 T A 7: 41,648,614 C225S probably benign Het
Zfp944 T A 17: 22,339,880 K129* probably null Het
Other mutations in Vps54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Vps54 APN 11 21277909 missense possibly damaging 0.74
IGL01070:Vps54 APN 11 21312268 missense probably damaging 1.00
IGL01398:Vps54 APN 11 21295403 splice site probably benign
IGL01450:Vps54 APN 11 21291135 missense probably benign 0.00
IGL01611:Vps54 APN 11 21311082 missense probably damaging 1.00
IGL01801:Vps54 APN 11 21275131 critical splice donor site probably null
IGL01872:Vps54 APN 11 21306940 missense probably damaging 0.99
IGL02071:Vps54 APN 11 21275071 missense probably null 0.00
IGL02186:Vps54 APN 11 21306947 missense probably damaging 1.00
IGL03358:Vps54 APN 11 21268799 missense probably damaging 1.00
muddle UTSW 11 21277670 splice site probably null
R0031:Vps54 UTSW 11 21312899 missense probably damaging 1.00
R0147:Vps54 UTSW 11 21300259 missense probably benign 0.02
R0158:Vps54 UTSW 11 21306962 missense probably damaging 1.00
R0385:Vps54 UTSW 11 21306381 missense possibly damaging 0.94
R0420:Vps54 UTSW 11 21311071 splice site probably benign
R0582:Vps54 UTSW 11 21300137 missense probably damaging 1.00
R0602:Vps54 UTSW 11 21306434 missense possibly damaging 0.92
R1051:Vps54 UTSW 11 21278001 frame shift probably null
R1280:Vps54 UTSW 11 21277868 missense possibly damaging 0.88
R1720:Vps54 UTSW 11 21306519 missense probably damaging 1.00
R1875:Vps54 UTSW 11 21300251 missense probably benign 0.00
R1883:Vps54 UTSW 11 21312967 missense possibly damaging 0.91
R1971:Vps54 UTSW 11 21292051 missense probably damaging 1.00
R2063:Vps54 UTSW 11 21277955 missense probably damaging 1.00
R2171:Vps54 UTSW 11 21298810 missense probably benign 0.16
R2518:Vps54 UTSW 11 21306394 missense probably benign 0.01
R3801:Vps54 UTSW 11 21268832 missense probably benign 0.00
R4049:Vps54 UTSW 11 21300183 missense probably benign 0.00
R4108:Vps54 UTSW 11 21312877 missense probably benign 0.02
R4560:Vps54 UTSW 11 21312260 missense possibly damaging 0.91
R4668:Vps54 UTSW 11 21299989 missense probably benign 0.04
R4772:Vps54 UTSW 11 21312952 missense probably damaging 1.00
R5061:Vps54 UTSW 11 21319881 utr 3 prime probably benign
R5611:Vps54 UTSW 11 21311130 missense possibly damaging 0.65
R5638:Vps54 UTSW 11 21308799 missense probably damaging 1.00
R5670:Vps54 UTSW 11 21264864 missense probably damaging 1.00
R7095:Vps54 UTSW 11 21271720 missense probably benign 0.12
R7175:Vps54 UTSW 11 21315028 critical splice donor site probably null
R7179:Vps54 UTSW 11 21298791 missense probably damaging 1.00
R7269:Vps54 UTSW 11 21277670 splice site probably null
R7286:Vps54 UTSW 11 21275005 missense probably benign 0.30
R7344:Vps54 UTSW 11 21274999 missense probably damaging 1.00
R7552:Vps54 UTSW 11 21298831 missense probably benign 0.08
R7897:Vps54 UTSW 11 21263307 missense probably benign 0.02
R8011:Vps54 UTSW 11 21275095 missense probably damaging 0.99
R8282:Vps54 UTSW 11 21300464 intron probably benign
R8534:Vps54 UTSW 11 21277706 missense probably benign 0.05
R8559:Vps54 UTSW 11 21264815 missense probably damaging 1.00
Z1177:Vps54 UTSW 11 21263206 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGGGAGGGGTCACATCATAC -3'
(R):5'- AAAGTAGTGGTCCTGGCTGC -3'

Sequencing Primer
(F):5'- GGGTCACATCATACTTCTGGAAGC -3'
(R):5'- TGACCAAGTATTACTATTATGCTGC -3'
Posted On2020-07-13