Incidental Mutation 'R8193:Utp18'
ID635305
Institutional Source Beutler Lab
Gene Symbol Utp18
Ensembl Gene ENSMUSG00000054079
Gene NameUTP18 small subunit processome component
Synonyms6230425C22Rik, Wdr50
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R8193 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location93859243-93885766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93876077 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 268 (D268G)
Ref Sequence ENSEMBL: ENSMUSP00000068103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066888]
Predicted Effect probably damaging
Transcript: ENSMUST00000066888
AA Change: D268G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068103
Gene: ENSMUSG00000054079
AA Change: D268G

DomainStartEndE-ValueType
low complexity region 43 64 N/A INTRINSIC
low complexity region 100 111 N/A INTRINSIC
low complexity region 139 146 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
WD40 236 275 7.4e0 SMART
WD40 280 320 3.08e0 SMART
Blast:WD40 325 365 4e-17 BLAST
WD40 368 406 2.23e-1 SMART
WD40 409 449 1.78e0 SMART
WD40 458 499 2.05e1 SMART
WD40 510 545 7.92e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,419,868 V48E possibly damaging Het
4930522H14Rik A G 4: 109,524,332 L83S probably benign Het
Abhd18 C A 3: 40,930,225 T233K probably benign Het
Adam26a A T 8: 43,569,236 C406S probably damaging Het
Anp32e G A 3: 95,929,398 probably benign Het
Cd33 C T 7: 43,532,272 A155T possibly damaging Het
Cdc25c A T 18: 34,749,622 probably null Het
Cep350 A G 1: 155,862,079 S2673P probably benign Het
Chodl T C 16: 78,941,524 S127P probably damaging Het
Clstn2 A G 9: 97,583,630 S103P probably damaging Het
Crocc2 T A 1: 93,190,166 probably null Het
Cyp24a1 A G 2: 170,485,702 L507P probably damaging Het
Dcbld2 T A 16: 58,464,010 probably null Het
Dnah14 T C 1: 181,688,205 Y1991H probably damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Edrf1 C T 7: 133,661,877 T971I possibly damaging Het
Ermap A G 4: 119,183,943 I290T possibly damaging Het
Eva1a A T 6: 82,091,940 S83C probably benign Het
Fcgbp A T 7: 28,104,851 N1795Y probably damaging Het
Foxg1 A G 12: 49,385,594 H370R possibly damaging Het
Gabra1 A G 11: 42,147,141 Y217H probably damaging Het
Gm3086 A G 12: 69,969,490 N62S noncoding transcript Het
Hmcn1 A T 1: 150,577,477 Y5362* probably null Het
Igkv5-37 C A 6: 69,963,812 probably benign Het
Ints3 A G 3: 90,400,622 V647A possibly damaging Het
Itga1 A G 13: 114,968,455 probably null Het
Limk2 T C 11: 3,347,691 K481E possibly damaging Het
Lonp2 G T 8: 86,631,463 G104V probably damaging Het
Lpar5 T C 6: 125,081,339 S8P probably benign Het
Map2k7 T C 8: 4,244,059 F202L probably benign Het
Mark1 T G 1: 184,928,052 M136L probably damaging Het
Myo15b T C 11: 115,885,147 S590P probably damaging Het
Nbas T C 12: 13,433,009 V1429A probably damaging Het
Nbeal1 T A 1: 60,253,481 Y1097* probably null Het
Ncf4 T C 15: 78,262,266 S299P probably damaging Het
Nfkbiz T C 16: 55,821,851 D68G probably damaging Het
Nomo1 T C 7: 46,042,613 S154P possibly damaging Het
Nrp1 G T 8: 128,460,706 W411L probably damaging Het
Olfr1015 T C 2: 85,785,961 V150A probably benign Het
Olfr1202 T A 2: 88,817,459 M96K probably damaging Het
Olfr141 T G 2: 86,806,865 I45L noncoding transcript Het
Olfr149 T C 9: 39,702,202 D189G possibly damaging Het
Olfr971 T C 9: 39,839,461 I9T probably benign Het
Pcsk5 A G 19: 17,586,051 V574A possibly damaging Het
Prex1 C A 2: 166,593,860 R589L possibly damaging Het
Prl7d1 A G 13: 27,709,247 V227A Het
Prpf40b T A 15: 99,304,068 F16I unknown Het
Rasa2 G A 9: 96,602,738 P141L probably damaging Het
Rtl1 A G 12: 109,592,216 V1063A probably benign Het
Sema4d A T 13: 51,705,156 C512* probably null Het
Slc19a2 A G 1: 164,257,225 N228S probably benign Het
Tcf4 A T 18: 69,500,923 probably benign Het
Tnks2 T C 19: 36,854,953 V264A possibly damaging Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Usp53 T C 3: 122,947,363 E746G probably benign Het
Vmn1r172 T A 7: 23,660,327 Y212* probably null Het
Vmn2r100 T A 17: 19,504,840 C10* probably null Het
Vmn2r113 G T 17: 22,945,527 V135F probably benign Het
Vps54 T C 11: 21,292,045 F387L probably benign Het
Xab2 A C 8: 3,613,389 D450E probably benign Het
Zfp408 G T 2: 91,645,016 R598S probably benign Het
Zfp788 T A 7: 41,648,614 C225S probably benign Het
Zfp944 T A 17: 22,339,880 K129* probably null Het
Other mutations in Utp18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Utp18 APN 11 93869848 missense possibly damaging 0.95
IGL02061:Utp18 APN 11 93882141 missense probably benign 0.05
IGL02402:Utp18 APN 11 93883791 unclassified probably benign
IGL02552:Utp18 APN 11 93868334 missense probably damaging 0.97
IGL03086:Utp18 APN 11 93876056 missense probably damaging 1.00
IGL03090:Utp18 APN 11 93868419 missense probably damaging 1.00
IGL03281:Utp18 APN 11 93875958 missense probably damaging 1.00
R0042:Utp18 UTSW 11 93875858 missense probably damaging 0.99
R0281:Utp18 UTSW 11 93882177 unclassified probably benign
R0399:Utp18 UTSW 11 93880147 splice site probably benign
R0543:Utp18 UTSW 11 93875835 missense probably damaging 1.00
R1512:Utp18 UTSW 11 93885564 missense probably benign 0.00
R1674:Utp18 UTSW 11 93876053 critical splice donor site probably null
R2013:Utp18 UTSW 11 93876122 missense possibly damaging 0.91
R4426:Utp18 UTSW 11 93866438 missense probably damaging 1.00
R4427:Utp18 UTSW 11 93866438 missense probably damaging 1.00
R4455:Utp18 UTSW 11 93885447 missense probably benign 0.09
R4458:Utp18 UTSW 11 93870533 missense possibly damaging 0.92
R5085:Utp18 UTSW 11 93870537 missense possibly damaging 0.78
R5297:Utp18 UTSW 11 93876089 missense probably damaging 0.99
R5321:Utp18 UTSW 11 93866434 missense probably damaging 1.00
R6006:Utp18 UTSW 11 93885623 missense probably benign 0.00
R6845:Utp18 UTSW 11 93885756 unclassified probably benign
R7211:Utp18 UTSW 11 93885380 missense probably benign 0.01
R7330:Utp18 UTSW 11 93882073 critical splice donor site probably null
RF015:Utp18 UTSW 11 93885461 missense probably damaging 1.00
Z1177:Utp18 UTSW 11 93875821 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTAAAGATTGGAAACTTCTCC -3'
(R):5'- CCAGAGCCACAATCATCTGG -3'

Sequencing Primer
(F):5'- ACTTCTCCAAATAGATGCTCTGG -3'
(R):5'- TCTGATACATGACTGCTGTGAAAGG -3'
Posted On2020-07-13