Incidental Mutation 'R8193:Chodl'
ID635317
Institutional Source Beutler Lab
Gene Symbol Chodl
Ensembl Gene ENSMUSG00000022860
Gene Namechondrolectin
SynonymsMT75, 3110074E07Rik, PRED12
MMRRC Submission
Accession Numbers

Genbank: NM_139134 ; MGI: 2179069

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8193 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location78930948-78951733 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78941524 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 127 (S127P)
Ref Sequence ENSEMBL: ENSMUSP00000063961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023568] [ENSMUST00000069148] [ENSMUST00000114216]
Predicted Effect probably damaging
Transcript: ENSMUST00000023568
AA Change: S127P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023568
Gene: ENSMUSG00000022860
AA Change: S127P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLECT 31 179 4.07e-25 SMART
transmembrane domain 218 240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000069148
AA Change: S127P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000063961
Gene: ENSMUSG00000022860
AA Change: S127P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLECT 31 179 4.07e-25 SMART
transmembrane domain 218 240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114216
AA Change: S127P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109854
Gene: ENSMUSG00000022860
AA Change: S127P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLECT 31 179 4.07e-25 SMART
transmembrane domain 218 240 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I membrane protein with a carbohydrate recognition domain characteristic of C-type lectins in its extracellular portion. In other proteins, this domain is involved in endocytosis of glycoproteins and exogenous sugar-bearing pathogens. This protein localizes predominantly to the perinuclear region. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,419,868 V48E possibly damaging Het
4930522H14Rik A G 4: 109,524,332 L83S probably benign Het
Abhd18 C A 3: 40,930,225 T233K probably benign Het
Adam26a A T 8: 43,569,236 C406S probably damaging Het
Anp32e G A 3: 95,929,398 probably benign Het
Cd33 C T 7: 43,532,272 A155T possibly damaging Het
Cdc25c A T 18: 34,749,622 probably null Het
Cep350 A G 1: 155,862,079 S2673P probably benign Het
Clstn2 A G 9: 97,583,630 S103P probably damaging Het
Crocc2 T A 1: 93,190,166 probably null Het
Cyp24a1 A G 2: 170,485,702 L507P probably damaging Het
Dcbld2 T A 16: 58,464,010 probably null Het
Dnah14 T C 1: 181,688,205 Y1991H probably damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Edrf1 C T 7: 133,661,877 T971I possibly damaging Het
Ermap A G 4: 119,183,943 I290T possibly damaging Het
Eva1a A T 6: 82,091,940 S83C probably benign Het
Fcgbp A T 7: 28,104,851 N1795Y probably damaging Het
Foxg1 A G 12: 49,385,594 H370R possibly damaging Het
Gabra1 A G 11: 42,147,141 Y217H probably damaging Het
Gm3086 A G 12: 69,969,490 N62S noncoding transcript Het
Hmcn1 A T 1: 150,577,477 Y5362* probably null Het
Igkv5-37 C A 6: 69,963,812 probably benign Het
Ints3 A G 3: 90,400,622 V647A possibly damaging Het
Itga1 A G 13: 114,968,455 probably null Het
Limk2 T C 11: 3,347,691 K481E possibly damaging Het
Lonp2 G T 8: 86,631,463 G104V probably damaging Het
Lpar5 T C 6: 125,081,339 S8P probably benign Het
Map2k7 T C 8: 4,244,059 F202L probably benign Het
Mark1 T G 1: 184,928,052 M136L probably damaging Het
Myo15b T C 11: 115,885,147 S590P probably damaging Het
Nbas T C 12: 13,433,009 V1429A probably damaging Het
Nbeal1 T A 1: 60,253,481 Y1097* probably null Het
Ncf4 T C 15: 78,262,266 S299P probably damaging Het
Nfkbiz T C 16: 55,821,851 D68G probably damaging Het
Nomo1 T C 7: 46,042,613 S154P possibly damaging Het
Nrp1 G T 8: 128,460,706 W411L probably damaging Het
Olfr1015 T C 2: 85,785,961 V150A probably benign Het
Olfr1202 T A 2: 88,817,459 M96K probably damaging Het
Olfr141 T G 2: 86,806,865 I45L noncoding transcript Het
Olfr149 T C 9: 39,702,202 D189G possibly damaging Het
Olfr971 T C 9: 39,839,461 I9T probably benign Het
Pcsk5 A G 19: 17,586,051 V574A possibly damaging Het
Prex1 C A 2: 166,593,860 R589L possibly damaging Het
Prl7d1 A G 13: 27,709,247 V227A Het
Prpf40b T A 15: 99,304,068 F16I unknown Het
Rasa2 G A 9: 96,602,738 P141L probably damaging Het
Rtl1 A G 12: 109,592,216 V1063A probably benign Het
Sema4d A T 13: 51,705,156 C512* probably null Het
Slc19a2 A G 1: 164,257,225 N228S probably benign Het
Tcf4 A T 18: 69,500,923 probably benign Het
Tnks2 T C 19: 36,854,953 V264A possibly damaging Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Usp53 T C 3: 122,947,363 E746G probably benign Het
Utp18 T C 11: 93,876,077 D268G probably damaging Het
Vmn1r172 T A 7: 23,660,327 Y212* probably null Het
Vmn2r100 T A 17: 19,504,840 C10* probably null Het
Vmn2r113 G T 17: 22,945,527 V135F probably benign Het
Vps54 T C 11: 21,292,045 F387L probably benign Het
Xab2 A C 8: 3,613,389 D450E probably benign Het
Zfp408 G T 2: 91,645,016 R598S probably benign Het
Zfp788 T A 7: 41,648,614 C225S probably benign Het
Zfp944 T A 17: 22,339,880 K129* probably null Het
Other mutations in Chodl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Chodl APN 16 78941263 missense probably damaging 1.00
IGL01632:Chodl APN 16 78944564 intron probably benign
IGL01968:Chodl APN 16 78941669 missense probably damaging 1.00
IGL03095:Chodl APN 16 78941433 missense probably damaging 1.00
R0125:Chodl UTSW 16 78941423 missense probably damaging 1.00
R1852:Chodl UTSW 16 78941258 missense probably benign 0.01
R1938:Chodl UTSW 16 78941426 missense possibly damaging 0.77
R2109:Chodl UTSW 16 78941363 missense possibly damaging 0.58
R4362:Chodl UTSW 16 78944658 critical splice donor site probably null
R4502:Chodl UTSW 16 78931444 missense possibly damaging 0.65
R5299:Chodl UTSW 16 78941408 missense probably damaging 0.99
R5386:Chodl UTSW 16 78946697 missense probably damaging 1.00
R5677:Chodl UTSW 16 78941315 missense probably damaging 1.00
R6959:Chodl UTSW 16 78946684 missense probably damaging 1.00
R7138:Chodl UTSW 16 78941447 missense probably damaging 1.00
R7147:Chodl UTSW 16 78946741 missense probably damaging 1.00
R8065:Chodl UTSW 16 78946713 missense probably damaging 1.00
R8067:Chodl UTSW 16 78946713 missense probably damaging 1.00
R8924:Chodl UTSW 16 78941771 missense possibly damaging 0.70
X0067:Chodl UTSW 16 78931373 missense possibly damaging 0.46
YA93:Chodl UTSW 16 78941282 missense probably benign 0.11
Z1177:Chodl UTSW 16 78941463 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- CTCCTGAGTCTTGAGAATGAAGC -3'
(R):5'- ACCTGTCGTCATTCCACTGG -3'

Sequencing Primer
(F):5'- CCTGAGTCTTGAGAATGAAGCTGAAC -3'
(R):5'- CGTCATTCCACTGGTAAAGGTAG -3'
Posted On2020-07-13