Incidental Mutation 'R8194:Mcmdc2'
ID 635324
Institutional Source Beutler Lab
Gene Symbol Mcmdc2
Ensembl Gene ENSMUSG00000046101
Gene Name minichromosome maintenance domain containing 2
Synonyms 6030422M02Rik
MMRRC Submission 067617-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R8194 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 9978863-10011179 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 9986867 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 219 (I219V)
Ref Sequence ENSEMBL: ENSMUSP00000054715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052843] [ENSMUST00000118098] [ENSMUST00000125294] [ENSMUST00000140948] [ENSMUST00000171802]
AlphaFold E9Q956
Predicted Effect probably benign
Transcript: ENSMUST00000052843
AA Change: I219V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000054715
Gene: ENSMUSG00000046101
AA Change: I219V

DomainStartEndE-ValueType
Blast:MCM 101 345 1e-140 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000118098
AA Change: I233V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112851
Gene: ENSMUSG00000046101
AA Change: I233V

DomainStartEndE-ValueType
Blast:MCM 115 358 1e-139 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000125294
AA Change: I233V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120858
Gene: ENSMUSG00000046101
AA Change: I233V

DomainStartEndE-ValueType
Blast:MCM 115 236 3e-73 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000140948
AA Change: I233V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120577
Gene: ENSMUSG00000046101
AA Change: I233V

DomainStartEndE-ValueType
Blast:MCM 115 358 1e-139 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000171802
AA Change: I233V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128620
Gene: ENSMUSG00000046101
AA Change: I233V

DomainStartEndE-ValueType
Pfam:MCM 503 623 1.4e-9 PFAM
low complexity region 658 665 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Homozygous knockout mice of both sexes are sterile as a result of abnormal meiosis. This in turn is caused by defective double-strand break DNA repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4a T A 12: 71,106,889 (GRCm39) Y320* probably null Het
Ash1l T A 3: 88,960,062 (GRCm39) C2265S probably damaging Het
Atg4b T A 1: 93,713,694 (GRCm39) C55* probably null Het
Cacna1s A T 1: 136,005,430 (GRCm39) N405I probably benign Het
Capn11 A T 17: 45,944,325 (GRCm39) D526E probably damaging Het
Ccdc188 A G 16: 18,036,244 (GRCm39) R71G probably benign Het
Ccser2 G A 14: 36,618,220 (GRCm39) R772W probably damaging Het
Cenpf T A 1: 189,414,600 (GRCm39) E172D probably benign Het
Cep85 T C 4: 133,861,400 (GRCm39) M627V probably null Het
Chd1 G A 17: 17,594,737 (GRCm39) probably benign Het
Cnst A G 1: 179,437,759 (GRCm39) H441R probably benign Het
Cyp2d11 G T 15: 82,274,638 (GRCm39) T313N probably damaging Het
Cyp2g1 A G 7: 26,514,159 (GRCm39) N255S possibly damaging Het
Dnah5 A G 15: 28,453,414 (GRCm39) D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 75,874,624 (GRCm39) probably benign Het
Fcnb C T 2: 27,968,330 (GRCm39) S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,217,364 (GRCm39) probably null Het
Lama4 A G 10: 38,954,716 (GRCm39) S1090G probably damaging Het
Malrd1 A G 2: 15,929,931 (GRCm39) D1479G unknown Het
Man2a2 T C 7: 80,010,766 (GRCm39) K742E probably benign Het
Mapk8 A T 14: 33,104,241 (GRCm39) S392T probably benign Het
Mark3 T C 12: 111,559,117 (GRCm39) I53T probably damaging Het
Mlycd A T 8: 120,134,332 (GRCm39) E278V probably benign Het
Muc2 G T 7: 141,290,801 (GRCm39) C29F Het
Mup20 T C 4: 61,971,721 (GRCm39) I77V probably benign Het
Myh3 A G 11: 66,982,828 (GRCm39) E849G probably damaging Het
Nedd4 A G 9: 72,593,389 (GRCm39) N154S probably damaging Het
Odad4 G A 11: 100,454,502 (GRCm39) G429E probably benign Het
Or1e1f A T 11: 73,856,240 (GRCm39) I269F probably benign Het
Pcdh7 A T 5: 57,877,678 (GRCm39) N411I probably damaging Het
Plekhm1 A G 11: 103,285,886 (GRCm39) I183T possibly damaging Het
Prkar2a G A 9: 108,569,710 (GRCm39) V19M probably damaging Het
Prss35 T G 9: 86,637,666 (GRCm39) N145K possibly damaging Het
Ranbp2 T A 10: 58,291,747 (GRCm39) D251E possibly damaging Het
Rnf169 C A 7: 99,575,651 (GRCm39) V315F probably damaging Het
Slc32a1 T C 2: 158,455,761 (GRCm39) Y139H probably damaging Het
Slc5a2 T C 7: 127,870,328 (GRCm39) V522A probably benign Het
Slc6a6 A T 6: 91,717,952 (GRCm39) Q297L probably damaging Het
Sos2 A C 12: 69,645,598 (GRCm39) Y914D probably damaging Het
Spata1 G T 3: 146,195,614 (GRCm39) T32N possibly damaging Het
Srcap C T 7: 127,138,369 (GRCm39) R1180C probably damaging Het
St14 A T 9: 31,042,921 (GRCm39) M1K probably null Het
Tcaf1 T C 6: 42,652,236 (GRCm39) T749A probably benign Het
Tcp1 T C 17: 13,141,621 (GRCm39) probably null Het
Tle6 A G 10: 81,426,888 (GRCm39) V576A probably damaging Het
Usp17lc T A 7: 103,067,407 (GRCm39) M234K probably benign Het
Washc4 A G 10: 83,416,163 (GRCm39) I818V possibly damaging Het
Zdhhc18 A G 4: 133,341,165 (GRCm39) L236P probably damaging Het
Zfp266 T C 9: 20,411,610 (GRCm39) D189G probably benign Het
Zfp474 A T 18: 52,772,229 (GRCm39) D294V probably damaging Het
Zfp568 T C 7: 29,722,758 (GRCm39) F568L probably damaging Het
Zfp93 A G 7: 23,975,479 (GRCm39) K488R probably benign Het
Other mutations in Mcmdc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02374:Mcmdc2 APN 1 9,982,207 (GRCm39) missense possibly damaging 0.85
IGL03087:Mcmdc2 APN 1 10,001,170 (GRCm39) missense possibly damaging 0.78
IGL03230:Mcmdc2 APN 1 10,002,221 (GRCm39) unclassified probably benign
R0313:Mcmdc2 UTSW 1 10,002,366 (GRCm39) missense probably damaging 1.00
R0448:Mcmdc2 UTSW 1 10,010,767 (GRCm39) makesense probably null
R0685:Mcmdc2 UTSW 1 9,982,039 (GRCm39) critical splice donor site probably null
R0926:Mcmdc2 UTSW 1 9,990,801 (GRCm39) nonsense probably null
R1590:Mcmdc2 UTSW 1 9,986,780 (GRCm39) nonsense probably null
R1867:Mcmdc2 UTSW 1 10,001,030 (GRCm39) missense probably damaging 1.00
R2356:Mcmdc2 UTSW 1 10,001,026 (GRCm39) missense possibly damaging 0.76
R5199:Mcmdc2 UTSW 1 9,990,660 (GRCm39) missense probably benign 0.37
R5341:Mcmdc2 UTSW 1 10,011,142 (GRCm39) frame shift probably null
R5459:Mcmdc2 UTSW 1 10,007,309 (GRCm39) missense probably benign 0.06
R5748:Mcmdc2 UTSW 1 9,982,032 (GRCm39) missense probably damaging 1.00
R6808:Mcmdc2 UTSW 1 10,004,242 (GRCm39) missense probably damaging 1.00
R6908:Mcmdc2 UTSW 1 10,001,003 (GRCm39) splice site probably null
R7123:Mcmdc2 UTSW 1 10,010,643 (GRCm39) missense unknown
R7233:Mcmdc2 UTSW 1 10,002,408 (GRCm39) critical splice donor site probably null
R7498:Mcmdc2 UTSW 1 9,989,302 (GRCm39) missense probably benign
R7646:Mcmdc2 UTSW 1 9,982,360 (GRCm39) missense possibly damaging 0.53
R7834:Mcmdc2 UTSW 1 9,982,399 (GRCm39) critical splice donor site probably null
R8118:Mcmdc2 UTSW 1 9,986,599 (GRCm39) missense possibly damaging 0.68
R8283:Mcmdc2 UTSW 1 10,004,263 (GRCm39) missense possibly damaging 0.85
R8434:Mcmdc2 UTSW 1 9,990,806 (GRCm39) missense possibly damaging 0.63
R8523:Mcmdc2 UTSW 1 9,981,946 (GRCm39) start codon destroyed probably null 0.87
R9244:Mcmdc2 UTSW 1 9,985,835 (GRCm39) missense probably damaging 1.00
R9281:Mcmdc2 UTSW 1 9,994,425 (GRCm39) missense probably damaging 1.00
X0025:Mcmdc2 UTSW 1 9,982,191 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGGAGCTACAGAATCTGCAAC -3'
(R):5'- CTCTGTGCAGCAAAATCCCC -3'

Sequencing Primer
(F):5'- GCTACAGAATCTGCAACAGTAAG -3'
(R):5'- TTACAGAGTGCCTCTAATGCCGG -3'
Posted On 2020-07-13