Mutagenetix > Incidental Mutation

Incidental Mutation 'R8194:Cacna1s'

635325

Institutional Source

Beutler Lab

Gene Symbol

Cacna1s

Ensembl Gene

ENSMUSG00000026407

Gene Name

calcium channel, voltage-dependent, L type, alpha 1S subunit

Synonyms

sj, mdg, muscle dysgenesis, DHPR alpha1s, Cav1.1, Cchl1a3, fmd

MMRRC Submission

Accession Numbers

Genbank: NM_001081023; MGI: 88294

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8194 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

136052750-136119822 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 136077692 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 405 (N405I)

Ref Sequence

ENSEMBL: ENSMUSP00000107699 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112064] [ENSMUST00000112068] [ENSMUST00000160641] [ENSMUST00000161865]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000112064
AA Change: N405I

PolyPhen 2 Score 0.333 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000107695
Gene: ENSMUSG00000026407
AA Change: N405I

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	50	345	4.3e-68	PFAM
Pfam:Ion_trans	431	672	4.5e-56	PFAM
Pfam:PKD_channel	516	667	1.9e-7	PFAM
low complexity region	675	685	N/A	INTRINSIC
low complexity region	740	756	N/A	INTRINSIC
Pfam:Ion_trans	798	1076	2.6e-65	PFAM
Pfam:Ion_trans	1117	1392	1.2e-71	PFAM
Pfam:PKD_channel	1126	1387	8.4e-13	PFAM
Pfam:GPHH	1394	1463	2.3e-38	PFAM
Ca_chan_IQ	1515	1548	3.71e-14	SMART
low complexity region	1657	1669	N/A	INTRINSIC
Pfam:CAC1F_C	1756	1845	2.8e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000112068
AA Change: N405I

PolyPhen 2 Score 0.333 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000107699
Gene: ENSMUSG00000026407
AA Change: N405I

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	88	333	9.1e-57	PFAM
PDB:4DEY\|B	334	417	1e-20	PDB
Pfam:Ion_trans	466	660	3.7e-46	PFAM
Pfam:PKD_channel	513	667	6.7e-7	PFAM
low complexity region	675	685	N/A	INTRINSIC
low complexity region	740	756	N/A	INTRINSIC
low complexity region	804	818	N/A	INTRINSIC
Pfam:Ion_trans	834	1064	3.9e-53	PFAM
Pfam:Ion_trans	1152	1361	6.7e-66	PFAM
Pfam:PKD_channel	1201	1368	8.4e-10	PFAM
Blast:EFh	1382	1410	5e-8	BLAST
Ca_chan_IQ	1496	1529	3.71e-14	SMART
low complexity region	1638	1650	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160641
AA Change: N405I

PolyPhen 2 Score 0.333 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000125278
Gene: ENSMUSG00000026407
AA Change: N405I

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	88	333	9.3e-57	PFAM
PDB:4DEY\|B	334	417	1e-20	PDB
Pfam:Ion_trans	466	660	3.8e-46	PFAM
Pfam:PKD_channel	513	667	6.7e-7	PFAM
low complexity region	675	685	N/A	INTRINSIC
low complexity region	740	756	N/A	INTRINSIC
low complexity region	804	818	N/A	INTRINSIC
Pfam:Ion_trans	834	1064	4e-53	PFAM
Pfam:PKD_channel	1126	1387	6.1e-12	PFAM
Pfam:Ion_trans	1152	1380	9e-65	PFAM
Blast:EFh	1401	1429	5e-8	BLAST
Ca_chan_IQ	1515	1548	3.71e-14	SMART
low complexity region	1657	1669	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161865
AA Change: N158I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000125262
Gene: ENSMUSG00000026407
AA Change: N158I

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	3	98	1.1e-21	PFAM
Pfam:Ion_trans	184	425	3.3e-56	PFAM
Pfam:PKD_channel	267	420	1.8e-7	PFAM
low complexity region	428	438	N/A	INTRINSIC
low complexity region	493	509	N/A	INTRINSIC
Pfam:Ion_trans	551	829	1.9e-65	PFAM
Pfam:Ion_trans	870	1126	5.4e-72	PFAM
Pfam:PKD_channel	954	1121	7.2e-10	PFAM
Pfam:GPHH	1128	1197	1.8e-38	PFAM
Ca_chan_IQ	1249	1282	3.71e-14	SMART
low complexity region	1391	1403	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

100% (51/51)

MGI Phenotype

Strain: 1856326
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the five subunits of the slowly inactivating L-type voltage-dependent calcium channel in skeletal muscle cells. Mutations in this gene have been associated with hypokalemic periodic paralysis, thyrotoxic periodic paralysis and malignant hyperthermia susceptibility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show edema and failure of myoblast differentiation by day 13 of embryonic development and die perinatally. All muscles degenerate and additional secondary anomalies of the skeleton, short jaw, and cleft palate are seen. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Spontaneous(1)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arid4a	T	A	12: 71,060,115	Y320*	probably null	Het
Ash1l	T	A	3: 89,052,755	C2265S	probably damaging	Het
Atg4b	T	A	1: 93,785,972	C55*	probably null	Het
Capn11	A	T	17: 45,633,399	D526E	probably damaging	Het
Ccdc188	A	G	16: 18,218,380	R71G	probably benign	Het
Ccser2	G	A	14: 36,896,263	R772W	probably damaging	Het
Cenpf	T	A	1: 189,682,403	E172D	probably benign	Het
Cep85	T	C	4: 134,134,089	M627V	probably null	Het
Chd1	G	A	17: 17,374,475		probably benign	Het
Cnst	A	G	1: 179,610,194	H441R	probably benign	Het
Cyp2d11	G	T	15: 82,390,437	T313N	probably damaging	Het
Cyp2g1	A	G	7: 26,814,734	N255S	possibly damaging	Het
Dnah5	A	G	15: 28,453,268	D4395G	probably damaging	Het
Fam83h	ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT	ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT	15: 76,002,775		probably benign	Het
Fcnb	C	T	2: 28,078,318	S209N	possibly damaging	Het
Gpsm1	CT	CTT	2: 26,327,352		probably null	Het
Lama4	A	G	10: 39,078,720	S1090G	probably damaging	Het
Malrd1	A	G	2: 15,925,120	D1479G	unknown	Het
Man2a2	T	C	7: 80,361,018	K742E	probably benign	Het
Mapk8	A	T	14: 33,382,284	S392T	probably benign	Het
Mark3	T	C	12: 111,592,683	I53T	probably damaging	Het
Mcmdc2	A	G	1: 9,916,642	I219V	probably benign	Het
Mlycd	A	T	8: 119,407,593	E278V	probably benign	Het
Muc2	G	T	7: 141,704,252	C29F		Het
Mup20	T	C	4: 62,053,484	I77V	probably benign	Het
Myh3	A	G	11: 67,092,002	E849G	probably damaging	Het
Nedd4	A	G	9: 72,686,107	N154S	probably damaging	Het
Olfr397	A	T	11: 73,965,414	I269F	probably benign	Het
Pcdh7	A	T	5: 57,720,336	N411I	probably damaging	Het
Plekhm1	A	G	11: 103,395,060	I183T	possibly damaging	Het
Prkar2a	G	A	9: 108,692,511	V19M	probably damaging	Het
Prss35	T	G	9: 86,755,613	N145K	possibly damaging	Het
Ranbp2	T	A	10: 58,455,925	D251E	possibly damaging	Het
Rnf169	C	A	7: 99,926,444	V315F	probably damaging	Het
Slc32a1	T	C	2: 158,613,841	Y139H	probably damaging	Het
Slc5a2	T	C	7: 128,271,156	V522A	probably benign	Het
Slc6a6	A	T	6: 91,740,971	Q297L	probably damaging	Het
Sos2	A	C	12: 69,598,824	Y914D	probably damaging	Het
Spata1	G	T	3: 146,489,859	T32N	possibly damaging	Het
Srcap	C	T	7: 127,539,197	R1180C	probably damaging	Het
St14	A	T	9: 31,131,625	M1K	probably null	Het
Tcaf1	T	C	6: 42,675,302	T749A	probably benign	Het
Tcp1	T	C	17: 12,922,734		probably null	Het
Tle6	A	G	10: 81,591,054	V576A	probably damaging	Het
Ttc25	G	A	11: 100,563,676	G429E	probably benign	Het
Usp17lc	T	A	7: 103,418,200	M234K	probably benign	Het
Washc4	A	G	10: 83,580,299	I818V	possibly damaging	Het
Zdhhc18	A	G	4: 133,613,854	L236P	probably damaging	Het
Zfp266	T	C	9: 20,500,314	D189G	probably benign	Het
Zfp474	A	T	18: 52,639,157	D294V	probably damaging	Het
Zfp568	T	C	7: 30,023,333	F568L	probably damaging	Het
Zfp93	A	G	7: 24,276,054	K488R	probably benign	Het

Other mutations in Cacna1s

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Cacna1s	APN	1	136084273	nonsense	probably null
IGL00517:Cacna1s	APN	1	136087339	missense	probably damaging	1.00
IGL01316:Cacna1s	APN	1	136118964	missense	probably benign	0.01
IGL01348:Cacna1s	APN	1	136075152	missense	possibly damaging	0.95
IGL01739:Cacna1s	APN	1	136097132	critical splice donor site	probably null
IGL01773:Cacna1s	APN	1	136118753	missense	probably benign	0.32
IGL02056:Cacna1s	APN	1	136119000	missense	probably benign
IGL02262:Cacna1s	APN	1	136108129	missense	probably damaging	0.98
IGL02324:Cacna1s	APN	1	136075176	splice site	probably benign
IGL02352:Cacna1s	APN	1	136093252	splice site	probably benign
IGL02359:Cacna1s	APN	1	136093252	splice site	probably benign
IGL02370:Cacna1s	APN	1	136085347	missense	probably damaging	1.00
IGL02377:Cacna1s	APN	1	136068994	missense	probably damaging	1.00
IGL02474:Cacna1s	APN	1	136118380	missense	probably benign
IGL02606:Cacna1s	APN	1	136079519	missense	probably damaging	0.99
IGL02833:Cacna1s	APN	1	136071005	missense	probably benign	0.03
IGL02974:Cacna1s	APN	1	136092617	missense	possibly damaging	0.78
IGL03064:Cacna1s	APN	1	136111993	missense	probably damaging	1.00
IGL03093:Cacna1s	APN	1	136116064	missense	probably benign	0.00
IGL03286:Cacna1s	APN	1	136077659	missense	probably benign
brookstone	UTSW	1	136092694	missense	probably benign	0.01
flyfish	UTSW	1	136116061	missense	probably benign	0.21
forelle	UTSW	1	136095858	missense	probably damaging	0.99
river	UTSW	1	136105844	missense	possibly damaging	0.88
stream	UTSW	1	136105814	missense	probably damaging	1.00
BB009:Cacna1s	UTSW	1	136084359	missense	probably damaging	0.99
BB019:Cacna1s	UTSW	1	136084359	missense	probably damaging	0.99
G1Funyon:Cacna1s	UTSW	1	136073441	unclassified	probably benign
N/A:Cacna1s	UTSW	1	136073509	missense	probably benign	0.00
R0030:Cacna1s	UTSW	1	136094989	critical splice donor site	probably null
R0030:Cacna1s	UTSW	1	136094989	critical splice donor site	probably null
R0097:Cacna1s	UTSW	1	136100622	missense	possibly damaging	0.79
R0097:Cacna1s	UTSW	1	136100622	missense	possibly damaging	0.79
R0240:Cacna1s	UTSW	1	136073496	unclassified	probably benign
R0255:Cacna1s	UTSW	1	136118806	missense	possibly damaging	0.93
R0302:Cacna1s	UTSW	1	136100604	missense	probably benign	0.01
R0319:Cacna1s	UTSW	1	136070717	missense	probably damaging	0.99
R0411:Cacna1s	UTSW	1	136113303	missense	probably damaging	1.00
R0413:Cacna1s	UTSW	1	136098209	missense	probably benign	0.00
R0482:Cacna1s	UTSW	1	136113394	missense	probably benign
R0491:Cacna1s	UTSW	1	136089008	splice site	probably benign
R0518:Cacna1s	UTSW	1	136076859	missense	probably benign
R0717:Cacna1s	UTSW	1	136098291	missense	probably damaging	1.00
R0725:Cacna1s	UTSW	1	136098526	splice site	probably benign
R0815:Cacna1s	UTSW	1	136112957	missense	possibly damaging	0.95
R1384:Cacna1s	UTSW	1	136094971	missense	probably benign	0.02
R1518:Cacna1s	UTSW	1	136098551	missense	probably damaging	1.00
R1548:Cacna1s	UTSW	1	136110937	missense	probably damaging	1.00
R1725:Cacna1s	UTSW	1	136098623	missense	probably damaging	1.00
R1728:Cacna1s	UTSW	1	136118716	missense	probably benign
R1729:Cacna1s	UTSW	1	136118716	missense	probably benign
R1730:Cacna1s	UTSW	1	136118716	missense	probably benign
R1739:Cacna1s	UTSW	1	136118716	missense	probably benign
R1762:Cacna1s	UTSW	1	136118716	missense	probably benign
R1783:Cacna1s	UTSW	1	136118716	missense	probably benign
R1784:Cacna1s	UTSW	1	136118716	missense	probably benign
R1785:Cacna1s	UTSW	1	136118716	missense	probably benign
R1800:Cacna1s	UTSW	1	136076854	missense	probably benign
R1924:Cacna1s	UTSW	1	136089017	splice site	probably null
R1969:Cacna1s	UTSW	1	136119095	missense	probably benign	0.42
R2072:Cacna1s	UTSW	1	136079504	missense	probably benign
R2380:Cacna1s	UTSW	1	136095848	missense	probably damaging	1.00
R3110:Cacna1s	UTSW	1	136075093	nonsense	probably null
R3112:Cacna1s	UTSW	1	136075093	nonsense	probably null
R3151:Cacna1s	UTSW	1	136105794	missense	probably damaging	1.00
R3696:Cacna1s	UTSW	1	136105814	missense	probably damaging	1.00
R3722:Cacna1s	UTSW	1	136069042	missense	possibly damaging	0.77
R3804:Cacna1s	UTSW	1	136107018	missense	possibly damaging	0.85
R3813:Cacna1s	UTSW	1	136085347	missense	probably damaging	1.00
R3905:Cacna1s	UTSW	1	136084269	missense	probably damaging	0.99
R3907:Cacna1s	UTSW	1	136084269	missense	probably damaging	0.99
R3909:Cacna1s	UTSW	1	136084269	missense	probably damaging	0.99
R4170:Cacna1s	UTSW	1	136108195	missense	probably damaging	1.00
R4329:Cacna1s	UTSW	1	136119033	missense	probably benign	0.00
R4485:Cacna1s	UTSW	1	136076852	missense	probably damaging	1.00
R4581:Cacna1s	UTSW	1	136070970	splice site	probably null
R4719:Cacna1s	UTSW	1	136118652	splice site	probably benign
R4816:Cacna1s	UTSW	1	136115269	missense	possibly damaging	0.89
R4909:Cacna1s	UTSW	1	136079604	missense	probably damaging	0.99
R4917:Cacna1s	UTSW	1	136101564	critical splice donor site	probably null
R5296:Cacna1s	UTSW	1	136095785	missense	probably benign	0.11
R5411:Cacna1s	UTSW	1	136105811	missense	probably benign	0.09
R5503:Cacna1s	UTSW	1	136086742	missense	probably damaging	1.00
R5533:Cacna1s	UTSW	1	136098375	critical splice donor site	probably null
R5714:Cacna1s	UTSW	1	136112066	missense	probably benign	0.44
R5775:Cacna1s	UTSW	1	136108122	missense	probably damaging	1.00
R5814:Cacna1s	UTSW	1	136107142	missense	probably benign	0.31
R5820:Cacna1s	UTSW	1	136079604	missense	probably damaging	1.00
R5822:Cacna1s	UTSW	1	136112078	missense	probably damaging	1.00
R5877:Cacna1s	UTSW	1	136100667	missense	probably damaging	0.99
R5923:Cacna1s	UTSW	1	136076822	missense	possibly damaging	0.79
R6021:Cacna1s	UTSW	1	136106487	missense	probably benign	0.15
R6037:Cacna1s	UTSW	1	136070967	missense	possibly damaging	0.90
R6037:Cacna1s	UTSW	1	136070967	missense	possibly damaging	0.90
R6056:Cacna1s	UTSW	1	136105836	missense	probably damaging	1.00
R6143:Cacna1s	UTSW	1	136076758	missense	probably damaging	0.99
R6222:Cacna1s	UTSW	1	136104622	missense	probably benign	0.00
R6237:Cacna1s	UTSW	1	136105844	missense	possibly damaging	0.88
R6274:Cacna1s	UTSW	1	136089045	missense	probably benign	0.02
R6609:Cacna1s	UTSW	1	136113391	missense	probably benign	0.30
R6626:Cacna1s	UTSW	1	136094965	missense	probably damaging	1.00
R6838:Cacna1s	UTSW	1	136084437	missense	possibly damaging	0.91
R6848:Cacna1s	UTSW	1	136092694	missense	probably benign	0.01
R6849:Cacna1s	UTSW	1	136092694	missense	probably benign	0.01
R6850:Cacna1s	UTSW	1	136092694	missense	probably benign	0.01
R6851:Cacna1s	UTSW	1	136092694	missense	probably benign	0.01
R6868:Cacna1s	UTSW	1	136092694	missense	probably benign	0.01
R6879:Cacna1s	UTSW	1	136115959	missense	probably benign	0.12
R6893:Cacna1s	UTSW	1	136077693	missense	probably benign	0.05
R7017:Cacna1s	UTSW	1	136095858	missense	probably damaging	0.99
R7228:Cacna1s	UTSW	1	136071059	missense	possibly damaging	0.90
R7283:Cacna1s	UTSW	1	136073708	missense	probably damaging	1.00
R7357:Cacna1s	UTSW	1	136071021	missense	probably damaging	0.99
R7385:Cacna1s	UTSW	1	136092633	missense	probably damaging	0.99
R7421:Cacna1s	UTSW	1	136086802	missense	probably damaging	1.00
R7505:Cacna1s	UTSW	1	136085449	nonsense	probably null
R7519:Cacna1s	UTSW	1	136070756	missense	probably damaging	0.99
R7675:Cacna1s	UTSW	1	136110874	missense	probably damaging	1.00
R7746:Cacna1s	UTSW	1	136069018	missense	probably damaging	0.99
R7779:Cacna1s	UTSW	1	136119029	missense	probably damaging	1.00
R7850:Cacna1s	UTSW	1	136071048	missense	probably damaging	1.00
R7932:Cacna1s	UTSW	1	136084359	missense	probably damaging	0.99
R7935:Cacna1s	UTSW	1	136092595	missense	possibly damaging	0.62
R7950:Cacna1s	UTSW	1	136100625	missense	probably benign	0.01
R7969:Cacna1s	UTSW	1	136076732	missense	probably damaging	1.00
R8083:Cacna1s	UTSW	1	136095791	missense	possibly damaging	0.91
R8101:Cacna1s	UTSW	1	136118665	missense	probably benign	0.02
R8123:Cacna1s	UTSW	1	136108179	missense	probably damaging	1.00
R8191:Cacna1s	UTSW	1	136108155	missense	probably damaging	1.00
R8251:Cacna1s	UTSW	1	136086723	missense	probably damaging	1.00
R8265:Cacna1s	UTSW	1	136092626	nonsense	probably null
R8301:Cacna1s	UTSW	1	136073441	unclassified	probably benign
R8310:Cacna1s	UTSW	1	136087337	missense	probably damaging	1.00
R8359:Cacna1s	UTSW	1	136116061	missense	probably benign	0.21
R8461:Cacna1s	UTSW	1	136073702	missense	possibly damaging	0.53
R8553:Cacna1s	UTSW	1	136091802	missense	possibly damaging	0.93
R8743:Cacna1s	UTSW	1	136105548	missense	probably damaging	1.00
R8766:Cacna1s	UTSW	1	136075143	missense	probably damaging	1.00
R8884:Cacna1s	UTSW	1	136115243	missense	probably benign	0.05
R8897:Cacna1s	UTSW	1	136117654	missense	probably benign	0.01
R8939:Cacna1s	UTSW	1	136086806	critical splice donor site	probably null
R8953:Cacna1s	UTSW	1	136097432	missense	possibly damaging	0.94
R9039:Cacna1s	UTSW	1	136088319	missense	probably benign
R9058:Cacna1s	UTSW	1	136070698	nonsense	probably null
R9137:Cacna1s	UTSW	1	136069006	missense	possibly damaging	0.89
R9332:Cacna1s	UTSW	1	136092714	nonsense	probably null
R9416:Cacna1s	UTSW	1	136094951	missense	possibly damaging	0.88
R9427:Cacna1s	UTSW	1	136084352	missense	probably benign	0.30
R9446:Cacna1s	UTSW	1	136117624	missense	probably benign	0.00
R9564:Cacna1s	UTSW	1	136118778	missense	probably benign
R9620:Cacna1s	UTSW	1	136108171	missense	probably damaging	1.00
X0025:Cacna1s	UTSW	1	136115970	missense	probably benign	0.00
Z1176:Cacna1s	UTSW	1	136107084	nonsense	probably null
Z1177:Cacna1s	UTSW	1	136117686	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCATCTTCAGTTCCCAAGAATCTG -3'
(R):5'- CTGATTGCACATTCCCTGGG -3'

Sequencing Primer
(F):5'- TCAGTTCCCAAGAATCTGGGTCAG -3'
(R):5'- ACATTCCCTGGGCATCTAGC -3'

Posted On

2020-07-13