Incidental Mutation 'R8194:Cnst'
ID 635326
Institutional Source Beutler Lab
Gene Symbol Cnst
Ensembl Gene ENSMUSG00000038949
Gene Name consortin, connexin sorting protein
Synonyms 9630058J23Rik
MMRRC Submission 067617-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.115) question?
Stock # R8194 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 179374009-179455043 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 179437759 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 441 (H441R)
Ref Sequence ENSEMBL: ENSMUSP00000048205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040706]
AlphaFold Q8CBC4
Predicted Effect probably benign
Transcript: ENSMUST00000040706
AA Change: H441R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048205
Gene: ENSMUSG00000038949
AA Change: H441R

DomainStartEndE-ValueType
low complexity region 109 126 N/A INTRINSIC
low complexity region 142 150 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
Pfam:Consortin_C 598 709 3.4e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Targeting of numerous transmembrane proteins to the cell surface is thought to depend on their recognition by cargo receptors that interact with the adaptor machinery for anterograde traffic at the distal end of the Golgi complex. Consortin (CNST) is an integral membrane protein that acts as a binding partner of connexins, the building blocks of gap junctions, and acts as a trans-Golgi network (TGN) receptor involved in connexin targeting to the plasma membrane and recycling from the cell surface (del Castillo et al., 2010 [PubMed 19864490]).[supplied by OMIM, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4a T A 12: 71,106,889 (GRCm39) Y320* probably null Het
Ash1l T A 3: 88,960,062 (GRCm39) C2265S probably damaging Het
Atg4b T A 1: 93,713,694 (GRCm39) C55* probably null Het
Cacna1s A T 1: 136,005,430 (GRCm39) N405I probably benign Het
Capn11 A T 17: 45,944,325 (GRCm39) D526E probably damaging Het
Ccdc188 A G 16: 18,036,244 (GRCm39) R71G probably benign Het
Ccser2 G A 14: 36,618,220 (GRCm39) R772W probably damaging Het
Cenpf T A 1: 189,414,600 (GRCm39) E172D probably benign Het
Cep85 T C 4: 133,861,400 (GRCm39) M627V probably null Het
Chd1 G A 17: 17,594,737 (GRCm39) probably benign Het
Cyp2d11 G T 15: 82,274,638 (GRCm39) T313N probably damaging Het
Cyp2g1 A G 7: 26,514,159 (GRCm39) N255S possibly damaging Het
Dnah5 A G 15: 28,453,414 (GRCm39) D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 75,874,624 (GRCm39) probably benign Het
Fcnb C T 2: 27,968,330 (GRCm39) S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,217,364 (GRCm39) probably null Het
Lama4 A G 10: 38,954,716 (GRCm39) S1090G probably damaging Het
Malrd1 A G 2: 15,929,931 (GRCm39) D1479G unknown Het
Man2a2 T C 7: 80,010,766 (GRCm39) K742E probably benign Het
Mapk8 A T 14: 33,104,241 (GRCm39) S392T probably benign Het
Mark3 T C 12: 111,559,117 (GRCm39) I53T probably damaging Het
Mcmdc2 A G 1: 9,986,867 (GRCm39) I219V probably benign Het
Mlycd A T 8: 120,134,332 (GRCm39) E278V probably benign Het
Muc2 G T 7: 141,290,801 (GRCm39) C29F Het
Mup20 T C 4: 61,971,721 (GRCm39) I77V probably benign Het
Myh3 A G 11: 66,982,828 (GRCm39) E849G probably damaging Het
Nedd4 A G 9: 72,593,389 (GRCm39) N154S probably damaging Het
Odad4 G A 11: 100,454,502 (GRCm39) G429E probably benign Het
Or1e1f A T 11: 73,856,240 (GRCm39) I269F probably benign Het
Pcdh7 A T 5: 57,877,678 (GRCm39) N411I probably damaging Het
Plekhm1 A G 11: 103,285,886 (GRCm39) I183T possibly damaging Het
Prkar2a G A 9: 108,569,710 (GRCm39) V19M probably damaging Het
Prss35 T G 9: 86,637,666 (GRCm39) N145K possibly damaging Het
Ranbp2 T A 10: 58,291,747 (GRCm39) D251E possibly damaging Het
Rnf169 C A 7: 99,575,651 (GRCm39) V315F probably damaging Het
Slc32a1 T C 2: 158,455,761 (GRCm39) Y139H probably damaging Het
Slc5a2 T C 7: 127,870,328 (GRCm39) V522A probably benign Het
Slc6a6 A T 6: 91,717,952 (GRCm39) Q297L probably damaging Het
Sos2 A C 12: 69,645,598 (GRCm39) Y914D probably damaging Het
Spata1 G T 3: 146,195,614 (GRCm39) T32N possibly damaging Het
Srcap C T 7: 127,138,369 (GRCm39) R1180C probably damaging Het
St14 A T 9: 31,042,921 (GRCm39) M1K probably null Het
Tcaf1 T C 6: 42,652,236 (GRCm39) T749A probably benign Het
Tcp1 T C 17: 13,141,621 (GRCm39) probably null Het
Tle6 A G 10: 81,426,888 (GRCm39) V576A probably damaging Het
Usp17lc T A 7: 103,067,407 (GRCm39) M234K probably benign Het
Washc4 A G 10: 83,416,163 (GRCm39) I818V possibly damaging Het
Zdhhc18 A G 4: 133,341,165 (GRCm39) L236P probably damaging Het
Zfp266 T C 9: 20,411,610 (GRCm39) D189G probably benign Het
Zfp474 A T 18: 52,772,229 (GRCm39) D294V probably damaging Het
Zfp568 T C 7: 29,722,758 (GRCm39) F568L probably damaging Het
Zfp93 A G 7: 23,975,479 (GRCm39) K488R probably benign Het
Other mutations in Cnst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Cnst APN 1 179,452,557 (GRCm39) splice site probably benign
Doldrums UTSW 1 179,432,638 (GRCm39) splice site probably null
ennui UTSW 1 179,434,100 (GRCm39) critical splice donor site probably null
R0360:Cnst UTSW 1 179,407,100 (GRCm39) missense probably benign 0.00
R1391:Cnst UTSW 1 179,407,051 (GRCm39) missense possibly damaging 0.81
R1743:Cnst UTSW 1 179,437,957 (GRCm39) missense probably benign 0.18
R1909:Cnst UTSW 1 179,450,356 (GRCm39) missense probably damaging 1.00
R3856:Cnst UTSW 1 179,407,279 (GRCm39) missense probably benign 0.02
R4565:Cnst UTSW 1 179,432,114 (GRCm39) missense probably damaging 1.00
R5041:Cnst UTSW 1 179,432,593 (GRCm39) missense probably damaging 0.99
R5072:Cnst UTSW 1 179,450,451 (GRCm39) missense possibly damaging 0.61
R5087:Cnst UTSW 1 179,450,378 (GRCm39) missense possibly damaging 0.82
R5294:Cnst UTSW 1 179,438,005 (GRCm39) missense probably benign 0.03
R5349:Cnst UTSW 1 179,450,462 (GRCm39) missense possibly damaging 0.58
R5394:Cnst UTSW 1 179,429,301 (GRCm39) splice site probably benign
R6020:Cnst UTSW 1 179,437,440 (GRCm39) missense probably benign
R6198:Cnst UTSW 1 179,420,430 (GRCm39) missense probably damaging 1.00
R6669:Cnst UTSW 1 179,432,638 (GRCm39) splice site probably null
R6767:Cnst UTSW 1 179,437,519 (GRCm39) missense possibly damaging 0.92
R7007:Cnst UTSW 1 179,438,133 (GRCm39) missense probably damaging 1.00
R7179:Cnst UTSW 1 179,406,947 (GRCm39) start gained probably benign
R7356:Cnst UTSW 1 179,434,095 (GRCm39) missense probably benign 0.01
R7730:Cnst UTSW 1 179,452,650 (GRCm39) missense probably damaging 1.00
R7900:Cnst UTSW 1 179,450,453 (GRCm39) missense probably damaging 1.00
R8073:Cnst UTSW 1 179,434,002 (GRCm39) missense probably benign 0.00
R8738:Cnst UTSW 1 179,420,274 (GRCm39) missense probably benign 0.00
R8857:Cnst UTSW 1 179,437,878 (GRCm39) missense probably damaging 1.00
R9035:Cnst UTSW 1 179,437,587 (GRCm39) missense possibly damaging 0.94
R9062:Cnst UTSW 1 179,434,100 (GRCm39) critical splice donor site probably null
R9106:Cnst UTSW 1 179,432,162 (GRCm39) missense probably damaging 1.00
R9190:Cnst UTSW 1 179,407,039 (GRCm39) small deletion probably benign
R9287:Cnst UTSW 1 179,407,108 (GRCm39) missense possibly damaging 0.61
R9429:Cnst UTSW 1 179,432,566 (GRCm39) missense probably damaging 1.00
Z1088:Cnst UTSW 1 179,407,130 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCGAATGCCTGCAAAGACAG -3'
(R):5'- TTCTGGGGCCATACACACTTC -3'

Sequencing Primer
(F):5'- TGCAAAGACAGCAGCTGC -3'
(R):5'- ACAGTGTGCTTACGTCACAG -3'
Posted On 2020-07-13