Incidental Mutation 'R8194:Cenpf'
ID 635327
Institutional Source Beutler Lab
Gene Symbol Cenpf
Ensembl Gene ENSMUSG00000026605
Gene Name centromere protein F
Synonyms 6530404A22Rik, mitosin, Lek1
MMRRC Submission 067617-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.527) question?
Stock # R8194 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 189372803-189420283 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 189414600 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 172 (E172D)
Ref Sequence ENSEMBL: ENSMUSP00000132759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165663] [ENSMUST00000165962] [ENSMUST00000171929]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000165663
SMART Domains Protein: ENSMUSP00000130308
Gene: ENSMUSG00000026605

DomainStartEndE-ValueType
Pfam:CENP-F_N 1 65 8.7e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165962
AA Change: E172D

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000132759
Gene: ENSMUSG00000026605
AA Change: E172D

DomainStartEndE-ValueType
Pfam:CENP-F_N 1 300 7.3e-135 PFAM
low complexity region 332 347 N/A INTRINSIC
low complexity region 361 379 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 572 592 N/A INTRINSIC
internal_repeat_1 737 759 3.18e-5 PROSPERO
internal_repeat_1 751 773 3.18e-5 PROSPERO
internal_repeat_2 789 804 5.94e-5 PROSPERO
coiled coil region 812 864 N/A INTRINSIC
coiled coil region 885 923 N/A INTRINSIC
low complexity region 925 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171929
AA Change: E172D

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000129738
Gene: ENSMUSG00000026605
AA Change: E172D

DomainStartEndE-ValueType
Pfam:CENP-F_N 1 300 2.8e-144 PFAM
low complexity region 349 364 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 589 609 N/A INTRINSIC
internal_repeat_5 678 707 8.32e-5 PROSPERO
internal_repeat_3 743 798 2.21e-5 PROSPERO
internal_repeat_1 780 812 2.12e-7 PROSPERO
coiled coil region 829 881 N/A INTRINSIC
coiled coil region 902 1169 N/A INTRINSIC
coiled coil region 1206 1364 N/A INTRINSIC
internal_repeat_2 1381 1413 3.02e-6 PROSPERO
internal_repeat_3 1412 1470 2.21e-5 PROSPERO
low complexity region 1526 1542 N/A INTRINSIC
coiled coil region 1560 1650 N/A INTRINSIC
internal_repeat_2 1655 1687 3.02e-6 PROSPERO
low complexity region 1744 1755 N/A INTRINSIC
coiled coil region 1822 1852 N/A INTRINSIC
Pfam:CENP-F_leu_zip 1893 2035 1.2e-14 PFAM
Pfam:CENP-F_leu_zip 2131 2270 1.5e-47 PFAM
Pfam:CENP-F_leu_zip 2313 2449 1e-46 PFAM
low complexity region 2544 2555 N/A INTRINSIC
low complexity region 2642 2654 N/A INTRINSIC
low complexity region 2755 2769 N/A INTRINSIC
internal_repeat_4 2778 2801 4.28e-5 PROSPERO
low complexity region 2837 2847 N/A INTRINSIC
Pfam:CENP-F_C_Rb_bdg 2850 2896 6.6e-29 PFAM
internal_repeat_1 2935 2964 2.12e-7 PROSPERO
internal_repeat_4 2946 2969 4.28e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that associates with the centromere-kinetochore complex. The protein is a component of the nuclear matrix during the G2 phase of interphase. In late G2 the protein associates with the kinetochore and maintains this association through early anaphase. It localizes to the spindle midzone and the intracellular bridge in late anaphase and telophase, respectively, and is thought to be subsequently degraded. The localization of this protein suggests that it may play a role in chromosome segregation during mitotis. It is thought to form either a homodimer or heterodimer. Autoantibodies against this protein have been found in patients with cancer or graft versus host disease. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4a T A 12: 71,106,889 (GRCm39) Y320* probably null Het
Ash1l T A 3: 88,960,062 (GRCm39) C2265S probably damaging Het
Atg4b T A 1: 93,713,694 (GRCm39) C55* probably null Het
Cacna1s A T 1: 136,005,430 (GRCm39) N405I probably benign Het
Capn11 A T 17: 45,944,325 (GRCm39) D526E probably damaging Het
Ccdc188 A G 16: 18,036,244 (GRCm39) R71G probably benign Het
Ccser2 G A 14: 36,618,220 (GRCm39) R772W probably damaging Het
Cep85 T C 4: 133,861,400 (GRCm39) M627V probably null Het
Chd1 G A 17: 17,594,737 (GRCm39) probably benign Het
Cnst A G 1: 179,437,759 (GRCm39) H441R probably benign Het
Cyp2d11 G T 15: 82,274,638 (GRCm39) T313N probably damaging Het
Cyp2g1 A G 7: 26,514,159 (GRCm39) N255S possibly damaging Het
Dnah5 A G 15: 28,453,414 (GRCm39) D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 75,874,624 (GRCm39) probably benign Het
Fcnb C T 2: 27,968,330 (GRCm39) S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,217,364 (GRCm39) probably null Het
Lama4 A G 10: 38,954,716 (GRCm39) S1090G probably damaging Het
Malrd1 A G 2: 15,929,931 (GRCm39) D1479G unknown Het
Man2a2 T C 7: 80,010,766 (GRCm39) K742E probably benign Het
Mapk8 A T 14: 33,104,241 (GRCm39) S392T probably benign Het
Mark3 T C 12: 111,559,117 (GRCm39) I53T probably damaging Het
Mcmdc2 A G 1: 9,986,867 (GRCm39) I219V probably benign Het
Mlycd A T 8: 120,134,332 (GRCm39) E278V probably benign Het
Muc2 G T 7: 141,290,801 (GRCm39) C29F Het
Mup20 T C 4: 61,971,721 (GRCm39) I77V probably benign Het
Myh3 A G 11: 66,982,828 (GRCm39) E849G probably damaging Het
Nedd4 A G 9: 72,593,389 (GRCm39) N154S probably damaging Het
Odad4 G A 11: 100,454,502 (GRCm39) G429E probably benign Het
Or1e1f A T 11: 73,856,240 (GRCm39) I269F probably benign Het
Pcdh7 A T 5: 57,877,678 (GRCm39) N411I probably damaging Het
Plekhm1 A G 11: 103,285,886 (GRCm39) I183T possibly damaging Het
Prkar2a G A 9: 108,569,710 (GRCm39) V19M probably damaging Het
Prss35 T G 9: 86,637,666 (GRCm39) N145K possibly damaging Het
Ranbp2 T A 10: 58,291,747 (GRCm39) D251E possibly damaging Het
Rnf169 C A 7: 99,575,651 (GRCm39) V315F probably damaging Het
Slc32a1 T C 2: 158,455,761 (GRCm39) Y139H probably damaging Het
Slc5a2 T C 7: 127,870,328 (GRCm39) V522A probably benign Het
Slc6a6 A T 6: 91,717,952 (GRCm39) Q297L probably damaging Het
Sos2 A C 12: 69,645,598 (GRCm39) Y914D probably damaging Het
Spata1 G T 3: 146,195,614 (GRCm39) T32N possibly damaging Het
Srcap C T 7: 127,138,369 (GRCm39) R1180C probably damaging Het
St14 A T 9: 31,042,921 (GRCm39) M1K probably null Het
Tcaf1 T C 6: 42,652,236 (GRCm39) T749A probably benign Het
Tcp1 T C 17: 13,141,621 (GRCm39) probably null Het
Tle6 A G 10: 81,426,888 (GRCm39) V576A probably damaging Het
Usp17lc T A 7: 103,067,407 (GRCm39) M234K probably benign Het
Washc4 A G 10: 83,416,163 (GRCm39) I818V possibly damaging Het
Zdhhc18 A G 4: 133,341,165 (GRCm39) L236P probably damaging Het
Zfp266 T C 9: 20,411,610 (GRCm39) D189G probably benign Het
Zfp474 A T 18: 52,772,229 (GRCm39) D294V probably damaging Het
Zfp568 T C 7: 29,722,758 (GRCm39) F568L probably damaging Het
Zfp93 A G 7: 23,975,479 (GRCm39) K488R probably benign Het
Other mutations in Cenpf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Cenpf APN 1 189,387,109 (GRCm39) missense probably benign 0.01
IGL01154:Cenpf APN 1 189,412,530 (GRCm39) missense probably benign 0.19
IGL01434:Cenpf APN 1 189,390,065 (GRCm39) nonsense probably null
IGL01461:Cenpf APN 1 189,389,293 (GRCm39) missense probably damaging 1.00
IGL01615:Cenpf APN 1 189,385,381 (GRCm39) missense possibly damaging 0.68
IGL01720:Cenpf APN 1 189,383,412 (GRCm39) missense probably damaging 0.99
IGL01720:Cenpf APN 1 189,414,583 (GRCm39) missense probably benign 0.05
IGL01803:Cenpf APN 1 189,386,968 (GRCm39) nonsense probably null
IGL02152:Cenpf APN 1 189,381,209 (GRCm39) missense probably benign
IGL02222:Cenpf APN 1 189,386,641 (GRCm39) missense probably benign
IGL02338:Cenpf APN 1 189,412,615 (GRCm39) missense probably damaging 1.00
IGL02580:Cenpf APN 1 189,389,638 (GRCm39) missense probably benign 0.20
IGL02629:Cenpf APN 1 189,384,531 (GRCm39) missense probably damaging 1.00
IGL02650:Cenpf APN 1 189,384,670 (GRCm39) missense possibly damaging 0.91
IGL02660:Cenpf APN 1 189,386,979 (GRCm39) missense probably damaging 1.00
IGL02703:Cenpf APN 1 189,391,955 (GRCm39) missense probably benign 0.14
IGL02809:Cenpf APN 1 189,414,555 (GRCm39) splice site probably benign
IGL02851:Cenpf APN 1 189,390,227 (GRCm39) missense probably damaging 1.00
IGL02903:Cenpf APN 1 189,379,073 (GRCm39) missense probably damaging 0.99
IGL03126:Cenpf APN 1 189,391,207 (GRCm39) missense probably damaging 1.00
IGL03235:Cenpf APN 1 189,416,124 (GRCm39) missense probably damaging 1.00
IGL03336:Cenpf APN 1 189,384,844 (GRCm39) missense probably damaging 0.99
IGL03402:Cenpf APN 1 189,387,273 (GRCm39) missense probably damaging 1.00
IGL02799:Cenpf UTSW 1 189,391,849 (GRCm39) missense probably damaging 1.00
R0011:Cenpf UTSW 1 189,382,903 (GRCm39) missense probably benign 0.05
R0129:Cenpf UTSW 1 189,391,847 (GRCm39) missense probably benign 0.26
R0157:Cenpf UTSW 1 189,384,556 (GRCm39) missense probably benign 0.07
R0270:Cenpf UTSW 1 189,382,911 (GRCm39) missense probably benign 0.01
R0607:Cenpf UTSW 1 189,414,660 (GRCm39) splice site probably null
R0621:Cenpf UTSW 1 189,404,825 (GRCm39) missense probably benign
R0639:Cenpf UTSW 1 189,390,259 (GRCm39) missense probably benign 0.01
R0653:Cenpf UTSW 1 189,392,183 (GRCm39) missense probably damaging 1.00
R0718:Cenpf UTSW 1 189,386,181 (GRCm39) missense probably damaging 1.00
R1157:Cenpf UTSW 1 189,390,650 (GRCm39) missense probably benign 0.20
R1331:Cenpf UTSW 1 189,374,998 (GRCm39) missense probably damaging 0.99
R1463:Cenpf UTSW 1 189,386,936 (GRCm39) missense probably damaging 0.97
R1514:Cenpf UTSW 1 189,411,338 (GRCm39) missense possibly damaging 0.67
R1529:Cenpf UTSW 1 189,392,235 (GRCm39) missense probably benign 0.00
R1574:Cenpf UTSW 1 189,384,910 (GRCm39) missense probably damaging 1.00
R1574:Cenpf UTSW 1 189,384,910 (GRCm39) missense probably damaging 1.00
R1662:Cenpf UTSW 1 189,389,968 (GRCm39) missense probably damaging 0.99
R1671:Cenpf UTSW 1 189,411,341 (GRCm39) splice site probably null
R1725:Cenpf UTSW 1 189,412,676 (GRCm39) missense probably damaging 0.99
R1743:Cenpf UTSW 1 189,386,460 (GRCm39) missense probably benign 0.19
R1874:Cenpf UTSW 1 189,416,013 (GRCm39) missense probably damaging 1.00
R1884:Cenpf UTSW 1 189,379,046 (GRCm39) missense probably benign
R1980:Cenpf UTSW 1 189,386,112 (GRCm39) missense probably benign 0.04
R2074:Cenpf UTSW 1 189,389,098 (GRCm39) missense probably damaging 1.00
R2096:Cenpf UTSW 1 189,385,656 (GRCm39) missense possibly damaging 0.95
R2109:Cenpf UTSW 1 189,411,264 (GRCm39) missense probably damaging 0.99
R2113:Cenpf UTSW 1 189,411,299 (GRCm39) missense probably damaging 0.96
R2134:Cenpf UTSW 1 189,390,839 (GRCm39) missense probably benign 0.03
R2209:Cenpf UTSW 1 189,384,795 (GRCm39) missense probably benign 0.04
R2875:Cenpf UTSW 1 189,390,841 (GRCm39) missense probably benign 0.11
R2876:Cenpf UTSW 1 189,390,841 (GRCm39) missense probably benign 0.11
R3433:Cenpf UTSW 1 189,392,146 (GRCm39) missense probably damaging 0.99
R3709:Cenpf UTSW 1 189,381,009 (GRCm39) missense possibly damaging 0.72
R3786:Cenpf UTSW 1 189,390,534 (GRCm39) missense probably damaging 1.00
R4014:Cenpf UTSW 1 189,385,356 (GRCm39) missense probably benign 0.01
R4108:Cenpf UTSW 1 189,416,065 (GRCm39) missense probably damaging 1.00
R4119:Cenpf UTSW 1 189,385,242 (GRCm39) missense probably benign 0.01
R4177:Cenpf UTSW 1 189,400,816 (GRCm39) missense possibly damaging 0.95
R4422:Cenpf UTSW 1 189,390,547 (GRCm39) missense probably damaging 1.00
R4546:Cenpf UTSW 1 189,386,847 (GRCm39) missense probably damaging 1.00
R4592:Cenpf UTSW 1 189,411,230 (GRCm39) missense probably damaging 1.00
R4643:Cenpf UTSW 1 189,391,786 (GRCm39) missense probably benign 0.00
R4650:Cenpf UTSW 1 189,392,235 (GRCm39) missense probably benign 0.00
R4801:Cenpf UTSW 1 189,383,417 (GRCm39) missense probably damaging 1.00
R4802:Cenpf UTSW 1 189,383,417 (GRCm39) missense probably damaging 1.00
R4817:Cenpf UTSW 1 189,414,566 (GRCm39) missense possibly damaging 0.93
R4871:Cenpf UTSW 1 189,390,728 (GRCm39) missense probably damaging 1.00
R5037:Cenpf UTSW 1 189,416,043 (GRCm39) missense probably damaging 1.00
R5106:Cenpf UTSW 1 189,416,005 (GRCm39) missense probably benign 0.00
R5208:Cenpf UTSW 1 189,403,243 (GRCm39) critical splice donor site probably null
R5213:Cenpf UTSW 1 189,387,177 (GRCm39) missense probably benign 0.04
R5237:Cenpf UTSW 1 189,391,730 (GRCm39) missense probably benign 0.28
R5255:Cenpf UTSW 1 189,404,824 (GRCm39) missense possibly damaging 0.49
R5378:Cenpf UTSW 1 189,385,663 (GRCm39) missense possibly damaging 0.95
R5468:Cenpf UTSW 1 189,384,568 (GRCm39) missense probably damaging 1.00
R5510:Cenpf UTSW 1 189,415,100 (GRCm39) missense probably benign 0.14
R5616:Cenpf UTSW 1 189,389,483 (GRCm39) missense probably damaging 1.00
R5652:Cenpf UTSW 1 189,389,279 (GRCm39) missense probably damaging 0.99
R5735:Cenpf UTSW 1 189,386,560 (GRCm39) missense probably benign 0.10
R5841:Cenpf UTSW 1 189,389,641 (GRCm39) missense possibly damaging 0.90
R5943:Cenpf UTSW 1 189,392,166 (GRCm39) missense possibly damaging 0.75
R6082:Cenpf UTSW 1 189,390,301 (GRCm39) missense probably benign 0.11
R6108:Cenpf UTSW 1 189,394,210 (GRCm39) missense probably benign 0.03
R6269:Cenpf UTSW 1 189,392,117 (GRCm39) missense probably benign 0.37
R6284:Cenpf UTSW 1 189,384,939 (GRCm39) missense probably damaging 1.00
R6425:Cenpf UTSW 1 189,392,095 (GRCm39) missense probably benign 0.09
R6587:Cenpf UTSW 1 189,390,571 (GRCm39) missense probably damaging 1.00
R6747:Cenpf UTSW 1 189,385,051 (GRCm39) missense probably benign 0.15
R6811:Cenpf UTSW 1 189,386,739 (GRCm39) missense probably benign 0.06
R6834:Cenpf UTSW 1 189,391,643 (GRCm39) missense probably damaging 1.00
R6951:Cenpf UTSW 1 189,385,989 (GRCm39) missense probably damaging 1.00
R7095:Cenpf UTSW 1 189,391,373 (GRCm39) missense probably benign 0.01
R7128:Cenpf UTSW 1 189,417,188 (GRCm39) missense probably damaging 1.00
R7185:Cenpf UTSW 1 189,385,686 (GRCm39) missense probably damaging 1.00
R7292:Cenpf UTSW 1 189,382,891 (GRCm39) missense probably damaging 1.00
R7353:Cenpf UTSW 1 189,386,335 (GRCm39) nonsense probably null
R7402:Cenpf UTSW 1 189,391,575 (GRCm39) nonsense probably null
R7460:Cenpf UTSW 1 189,386,247 (GRCm39) missense probably damaging 0.97
R7484:Cenpf UTSW 1 189,389,018 (GRCm39) missense probably damaging 1.00
R7574:Cenpf UTSW 1 189,390,864 (GRCm39) missense probably damaging 1.00
R7691:Cenpf UTSW 1 189,390,404 (GRCm39) nonsense probably null
R7698:Cenpf UTSW 1 189,394,269 (GRCm39) missense probably benign 0.01
R7901:Cenpf UTSW 1 189,389,445 (GRCm39) missense probably damaging 1.00
R7941:Cenpf UTSW 1 189,389,483 (GRCm39) missense probably damaging 1.00
R8007:Cenpf UTSW 1 189,379,144 (GRCm39) missense
R8420:Cenpf UTSW 1 189,404,782 (GRCm39) missense probably damaging 1.00
R8429:Cenpf UTSW 1 189,389,504 (GRCm39) missense possibly damaging 0.72
R8477:Cenpf UTSW 1 189,385,385 (GRCm39) missense probably benign
R8492:Cenpf UTSW 1 189,390,926 (GRCm39) missense probably damaging 0.99
R8510:Cenpf UTSW 1 189,382,903 (GRCm39) missense probably benign 0.01
R8686:Cenpf UTSW 1 189,391,801 (GRCm39) missense probably benign 0.00
R8696:Cenpf UTSW 1 189,390,194 (GRCm39) missense probably benign 0.20
R8855:Cenpf UTSW 1 189,385,430 (GRCm39) missense probably benign 0.11
R8901:Cenpf UTSW 1 189,394,248 (GRCm39) missense probably benign 0.30
R8958:Cenpf UTSW 1 189,385,350 (GRCm39) missense possibly damaging 0.81
R9109:Cenpf UTSW 1 189,391,571 (GRCm39) missense probably benign 0.06
R9135:Cenpf UTSW 1 189,404,746 (GRCm39) missense probably damaging 1.00
R9136:Cenpf UTSW 1 189,403,352 (GRCm39) missense probably benign 0.02
R9198:Cenpf UTSW 1 189,388,987 (GRCm39) missense probably damaging 1.00
R9240:Cenpf UTSW 1 189,389,167 (GRCm39) missense probably benign 0.01
R9303:Cenpf UTSW 1 189,392,271 (GRCm39) critical splice acceptor site probably null
R9305:Cenpf UTSW 1 189,392,271 (GRCm39) critical splice acceptor site probably null
R9354:Cenpf UTSW 1 189,379,114 (GRCm39) missense
R9502:Cenpf UTSW 1 189,388,978 (GRCm39) missense probably damaging 1.00
R9619:Cenpf UTSW 1 189,385,965 (GRCm39) missense probably benign 0.01
RF006:Cenpf UTSW 1 189,389,583 (GRCm39) missense probably damaging 1.00
X0025:Cenpf UTSW 1 189,386,071 (GRCm39) missense possibly damaging 0.79
X0066:Cenpf UTSW 1 189,390,126 (GRCm39) missense probably benign 0.23
Z1088:Cenpf UTSW 1 189,385,128 (GRCm39) missense probably damaging 1.00
Z1176:Cenpf UTSW 1 189,391,669 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCATCTTGCTAGCCTTG -3'
(R):5'- TTGACATATTGCTCCACAGTGTTC -3'

Sequencing Primer
(F):5'- GAAAAATAATCACTACCAAACGAGGG -3'
(R):5'- CTTAGCACAATGATTGTTGATC -3'
Posted On 2020-07-13