Mutagenetix > Incidental Mutation

Incidental Mutation 'R8194:Cenpf'

635327

Institutional Source

Beutler Lab

Gene Symbol

Cenpf

Ensembl Gene

ENSMUSG00000026605

Gene Name

centromere protein F

Synonyms

mitosin, 6530404A22Rik, Lek1

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.460) question?

Stock #

R8194 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

189640606-189688086 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 189682403 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 172 (E172D)

Ref Sequence

ENSEMBL: ENSMUSP00000132759 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165663] [ENSMUST00000165962] [ENSMUST00000171929]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000165663

SMART Domains

Protein: ENSMUSP00000130308
Gene: ENSMUSG00000026605

Domain	Start	End	E-Value	Type
Pfam:CENP-F_N	1	65	8.7e-35	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165962
AA Change: E172D

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000132759
Gene: ENSMUSG00000026605
AA Change: E172D

Domain	Start	End	E-Value	Type
Pfam:CENP-F_N	1	300	7.3e-135	PFAM
low complexity region	332	347	N/A	INTRINSIC
low complexity region	361	379	N/A	INTRINSIC
low complexity region	527	540	N/A	INTRINSIC
low complexity region	572	592	N/A	INTRINSIC
internal_repeat_1	737	759	3.18e-5	PROSPERO
internal_repeat_1	751	773	3.18e-5	PROSPERO
internal_repeat_2	789	804	5.94e-5	PROSPERO
coiled coil region	812	864	N/A	INTRINSIC
coiled coil region	885	923	N/A	INTRINSIC
low complexity region	925	936	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000171929
AA Change: E172D

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000129738
Gene: ENSMUSG00000026605
AA Change: E172D

Domain	Start	End	E-Value	Type
Pfam:CENP-F_N	1	300	2.8e-144	PFAM
low complexity region	349	364	N/A	INTRINSIC
low complexity region	378	396	N/A	INTRINSIC
low complexity region	544	557	N/A	INTRINSIC
low complexity region	589	609	N/A	INTRINSIC
internal_repeat_5	678	707	8.32e-5	PROSPERO
internal_repeat_3	743	798	2.21e-5	PROSPERO
internal_repeat_1	780	812	2.12e-7	PROSPERO
coiled coil region	829	881	N/A	INTRINSIC
coiled coil region	902	1169	N/A	INTRINSIC
coiled coil region	1206	1364	N/A	INTRINSIC
internal_repeat_2	1381	1413	3.02e-6	PROSPERO
internal_repeat_3	1412	1470	2.21e-5	PROSPERO
low complexity region	1526	1542	N/A	INTRINSIC
coiled coil region	1560	1650	N/A	INTRINSIC
internal_repeat_2	1655	1687	3.02e-6	PROSPERO
low complexity region	1744	1755	N/A	INTRINSIC
coiled coil region	1822	1852	N/A	INTRINSIC
Pfam:CENP-F_leu_zip	1893	2035	1.2e-14	PFAM
Pfam:CENP-F_leu_zip	2131	2270	1.5e-47	PFAM
Pfam:CENP-F_leu_zip	2313	2449	1e-46	PFAM
low complexity region	2544	2555	N/A	INTRINSIC
low complexity region	2642	2654	N/A	INTRINSIC
low complexity region	2755	2769	N/A	INTRINSIC
internal_repeat_4	2778	2801	4.28e-5	PROSPERO
low complexity region	2837	2847	N/A	INTRINSIC
Pfam:CENP-F_C_Rb_bdg	2850	2896	6.6e-29	PFAM
internal_repeat_1	2935	2964	2.12e-7	PROSPERO
internal_repeat_4	2946	2969	4.28e-5	PROSPERO

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that associates with the centromere-kinetochore complex. The protein is a component of the nuclear matrix during the G2 phase of interphase. In late G2 the protein associates with the kinetochore and maintains this association through early anaphase. It localizes to the spindle midzone and the intracellular bridge in late anaphase and telophase, respectively, and is thought to be subsequently degraded. The localization of this protein suggests that it may play a role in chromosome segregation during mitotis. It is thought to form either a homodimer or heterodimer. Autoantibodies against this protein have been found in patients with cancer or graft versus host disease. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arid4a	T	A	12: 71,060,115	Y320*	probably null	Het
Ash1l	T	A	3: 89,052,755	C2265S	probably damaging	Het
Atg4b	T	A	1: 93,785,972	C55*	probably null	Het
Cacna1s	A	T	1: 136,077,692	N405I	probably benign	Het
Capn11	A	T	17: 45,633,399	D526E	probably damaging	Het
Ccdc188	A	G	16: 18,218,380	R71G	probably benign	Het
Ccser2	G	A	14: 36,896,263	R772W	probably damaging	Het
Cep85	T	C	4: 134,134,089	M627V	probably null	Het
Chd1	G	A	17: 17,374,475		probably benign	Het
Cnst	A	G	1: 179,610,194	H441R	probably benign	Het
Cyp2d11	G	T	15: 82,390,437	T313N	probably damaging	Het
Cyp2g1	A	G	7: 26,814,734	N255S	possibly damaging	Het
Dnah5	A	G	15: 28,453,268	D4395G	probably damaging	Het
Fam83h	ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT	ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT	15: 76,002,775		probably benign	Het
Fcnb	C	T	2: 28,078,318	S209N	possibly damaging	Het
Gpsm1	CT	CTT	2: 26,327,352		probably null	Het
Lama4	A	G	10: 39,078,720	S1090G	probably damaging	Het
Malrd1	A	G	2: 15,925,120	D1479G	unknown	Het
Man2a2	T	C	7: 80,361,018	K742E	probably benign	Het
Mapk8	A	T	14: 33,382,284	S392T	probably benign	Het
Mark3	T	C	12: 111,592,683	I53T	probably damaging	Het
Mcmdc2	A	G	1: 9,916,642	I219V	probably benign	Het
Mlycd	A	T	8: 119,407,593	E278V	probably benign	Het
Muc2	G	T	7: 141,704,252	C29F		Het
Mup20	T	C	4: 62,053,484	I77V	probably benign	Het
Myh3	A	G	11: 67,092,002	E849G	probably damaging	Het
Nedd4	A	G	9: 72,686,107	N154S	probably damaging	Het
Olfr397	A	T	11: 73,965,414	I269F	probably benign	Het
Pcdh7	A	T	5: 57,720,336	N411I	probably damaging	Het
Plekhm1	A	G	11: 103,395,060	I183T	possibly damaging	Het
Prkar2a	G	A	9: 108,692,511	V19M	probably damaging	Het
Prss35	T	G	9: 86,755,613	N145K	possibly damaging	Het
Ranbp2	T	A	10: 58,455,925	D251E	possibly damaging	Het
Rnf169	C	A	7: 99,926,444	V315F	probably damaging	Het
Slc32a1	T	C	2: 158,613,841	Y139H	probably damaging	Het
Slc5a2	T	C	7: 128,271,156	V522A	probably benign	Het
Slc6a6	A	T	6: 91,740,971	Q297L	probably damaging	Het
Sos2	A	C	12: 69,598,824	Y914D	probably damaging	Het
Spata1	G	T	3: 146,489,859	T32N	possibly damaging	Het
Srcap	C	T	7: 127,539,197	R1180C	probably damaging	Het
St14	A	T	9: 31,131,625	M1K	probably null	Het
Tcaf1	T	C	6: 42,675,302	T749A	probably benign	Het
Tcp1	T	C	17: 12,922,734		probably null	Het
Tle6	A	G	10: 81,591,054	V576A	probably damaging	Het
Ttc25	G	A	11: 100,563,676	G429E	probably benign	Het
Usp17lc	T	A	7: 103,418,200	M234K	probably benign	Het
Washc4	A	G	10: 83,580,299	I818V	possibly damaging	Het
Zdhhc18	A	G	4: 133,613,854	L236P	probably damaging	Het
Zfp266	T	C	9: 20,500,314	D189G	probably benign	Het
Zfp474	A	T	18: 52,639,157	D294V	probably damaging	Het
Zfp568	T	C	7: 30,023,333	F568L	probably damaging	Het
Zfp93	A	G	7: 24,276,054	K488R	probably benign	Het

Other mutations in Cenpf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Cenpf	APN	1	189654912	missense	probably benign	0.01
IGL01154:Cenpf	APN	1	189680333	missense	probably benign	0.19
IGL01434:Cenpf	APN	1	189657868	nonsense	probably null
IGL01461:Cenpf	APN	1	189657096	missense	probably damaging	1.00
IGL01615:Cenpf	APN	1	189653184	missense	possibly damaging	0.68
IGL01720:Cenpf	APN	1	189682386	missense	probably benign	0.05
IGL01720:Cenpf	APN	1	189651215	missense	probably damaging	0.99
IGL01803:Cenpf	APN	1	189654771	nonsense	probably null
IGL02152:Cenpf	APN	1	189649012	missense	probably benign
IGL02222:Cenpf	APN	1	189654444	missense	probably benign
IGL02338:Cenpf	APN	1	189680418	missense	probably damaging	1.00
IGL02580:Cenpf	APN	1	189657441	missense	probably benign	0.20
IGL02629:Cenpf	APN	1	189652334	missense	probably damaging	1.00
IGL02650:Cenpf	APN	1	189652473	missense	possibly damaging	0.91
IGL02660:Cenpf	APN	1	189654782	missense	probably damaging	1.00
IGL02703:Cenpf	APN	1	189659758	missense	probably benign	0.14
IGL02809:Cenpf	APN	1	189682358	splice site	probably benign
IGL02851:Cenpf	APN	1	189658030	missense	probably damaging	1.00
IGL02903:Cenpf	APN	1	189646876	missense	probably damaging	0.99
IGL03126:Cenpf	APN	1	189659010	missense	probably damaging	1.00
IGL03235:Cenpf	APN	1	189683927	missense	probably damaging	1.00
IGL03336:Cenpf	APN	1	189652647	missense	probably damaging	0.99
IGL03402:Cenpf	APN	1	189655076	missense	probably damaging	1.00
IGL02799:Cenpf	UTSW	1	189659652	missense	probably damaging	1.00
R0011:Cenpf	UTSW	1	189650706	missense	probably benign	0.05
R0129:Cenpf	UTSW	1	189659650	missense	probably benign	0.26
R0157:Cenpf	UTSW	1	189652359	missense	probably benign	0.07
R0270:Cenpf	UTSW	1	189650714	missense	probably benign	0.01
R0607:Cenpf	UTSW	1	189682463	splice site	probably null
R0621:Cenpf	UTSW	1	189672628	missense	probably benign
R0639:Cenpf	UTSW	1	189658062	missense	probably benign	0.01
R0653:Cenpf	UTSW	1	189659986	missense	probably damaging	1.00
R0718:Cenpf	UTSW	1	189653984	missense	probably damaging	1.00
R1157:Cenpf	UTSW	1	189658453	missense	probably benign	0.20
R1331:Cenpf	UTSW	1	189642801	missense	probably damaging	0.99
R1463:Cenpf	UTSW	1	189654739	missense	probably damaging	0.97
R1514:Cenpf	UTSW	1	189679141	missense	possibly damaging	0.67
R1529:Cenpf	UTSW	1	189660038	missense	probably benign	0.00
R1574:Cenpf	UTSW	1	189652713	missense	probably damaging	1.00
R1574:Cenpf	UTSW	1	189652713	missense	probably damaging	1.00
R1662:Cenpf	UTSW	1	189657771	missense	probably damaging	0.99
R1671:Cenpf	UTSW	1	189679144	splice site	probably null
R1725:Cenpf	UTSW	1	189680479	missense	probably damaging	0.99
R1743:Cenpf	UTSW	1	189654263	missense	probably benign	0.19
R1874:Cenpf	UTSW	1	189683816	missense	probably damaging	1.00
R1884:Cenpf	UTSW	1	189646849	missense	probably benign
R1980:Cenpf	UTSW	1	189653915	missense	probably benign	0.04
R2074:Cenpf	UTSW	1	189656901	missense	probably damaging	1.00
R2096:Cenpf	UTSW	1	189653459	missense	possibly damaging	0.95
R2109:Cenpf	UTSW	1	189679067	missense	probably damaging	0.99
R2113:Cenpf	UTSW	1	189679102	missense	probably damaging	0.96
R2134:Cenpf	UTSW	1	189658642	missense	probably benign	0.03
R2209:Cenpf	UTSW	1	189652598	missense	probably benign	0.04
R2875:Cenpf	UTSW	1	189658644	missense	probably benign	0.11
R2876:Cenpf	UTSW	1	189658644	missense	probably benign	0.11
R3433:Cenpf	UTSW	1	189659949	missense	probably damaging	0.99
R3709:Cenpf	UTSW	1	189648812	missense	possibly damaging	0.72
R3786:Cenpf	UTSW	1	189658337	missense	probably damaging	1.00
R4014:Cenpf	UTSW	1	189653159	missense	probably benign	0.01
R4108:Cenpf	UTSW	1	189683868	missense	probably damaging	1.00
R4119:Cenpf	UTSW	1	189653045	missense	probably benign	0.01
R4177:Cenpf	UTSW	1	189668619	missense	possibly damaging	0.95
R4422:Cenpf	UTSW	1	189658350	missense	probably damaging	1.00
R4546:Cenpf	UTSW	1	189654650	missense	probably damaging	1.00
R4592:Cenpf	UTSW	1	189679033	missense	probably damaging	1.00
R4643:Cenpf	UTSW	1	189659589	missense	probably benign	0.00
R4650:Cenpf	UTSW	1	189660038	missense	probably benign	0.00
R4801:Cenpf	UTSW	1	189651220	missense	probably damaging	1.00
R4802:Cenpf	UTSW	1	189651220	missense	probably damaging	1.00
R4817:Cenpf	UTSW	1	189682369	missense	possibly damaging	0.93
R4871:Cenpf	UTSW	1	189658531	missense	probably damaging	1.00
R5037:Cenpf	UTSW	1	189683846	missense	probably damaging	1.00
R5106:Cenpf	UTSW	1	189683808	missense	probably benign	0.00
R5208:Cenpf	UTSW	1	189671046	critical splice donor site	probably null
R5213:Cenpf	UTSW	1	189654980	missense	probably benign	0.04
R5237:Cenpf	UTSW	1	189659533	missense	probably benign	0.28
R5255:Cenpf	UTSW	1	189672627	missense	possibly damaging	0.49
R5378:Cenpf	UTSW	1	189653466	missense	possibly damaging	0.95
R5468:Cenpf	UTSW	1	189652371	missense	probably damaging	1.00
R5510:Cenpf	UTSW	1	189682903	missense	probably benign	0.14
R5616:Cenpf	UTSW	1	189657286	missense	probably damaging	1.00
R5652:Cenpf	UTSW	1	189657082	missense	probably damaging	0.99
R5735:Cenpf	UTSW	1	189654363	missense	probably benign	0.10
R5841:Cenpf	UTSW	1	189657444	missense	possibly damaging	0.90
R5943:Cenpf	UTSW	1	189659969	missense	possibly damaging	0.75
R6082:Cenpf	UTSW	1	189658104	missense	probably benign	0.11
R6108:Cenpf	UTSW	1	189662013	missense	probably benign	0.03
R6269:Cenpf	UTSW	1	189659920	missense	probably benign	0.37
R6284:Cenpf	UTSW	1	189652742	missense	probably damaging	1.00
R6425:Cenpf	UTSW	1	189659898	missense	probably benign	0.09
R6587:Cenpf	UTSW	1	189658374	missense	probably damaging	1.00
R6747:Cenpf	UTSW	1	189652854	missense	probably benign	0.15
R6811:Cenpf	UTSW	1	189654542	missense	probably benign	0.06
R6834:Cenpf	UTSW	1	189659446	missense	probably damaging	1.00
R6951:Cenpf	UTSW	1	189653792	missense	probably damaging	1.00
R7095:Cenpf	UTSW	1	189659176	missense	probably benign	0.01
R7128:Cenpf	UTSW	1	189684991	missense	probably damaging	1.00
R7185:Cenpf	UTSW	1	189653489	missense	probably damaging	1.00
R7292:Cenpf	UTSW	1	189650694	missense	probably damaging	1.00
R7353:Cenpf	UTSW	1	189654138	nonsense	probably null
R7402:Cenpf	UTSW	1	189659378	nonsense	probably null
R7460:Cenpf	UTSW	1	189654050	missense	probably damaging	0.97
R7484:Cenpf	UTSW	1	189656821	missense	probably damaging	1.00
R7574:Cenpf	UTSW	1	189658667	missense	probably damaging	1.00
R7691:Cenpf	UTSW	1	189658207	nonsense	probably null
R7698:Cenpf	UTSW	1	189662072	missense	probably benign	0.01
R7901:Cenpf	UTSW	1	189657248	missense	probably damaging	1.00
R7941:Cenpf	UTSW	1	189657286	missense	probably damaging	1.00
R8007:Cenpf	UTSW	1	189646947	missense
R8420:Cenpf	UTSW	1	189672585	missense	probably damaging	1.00
R8429:Cenpf	UTSW	1	189657307	missense	possibly damaging	0.72
R8477:Cenpf	UTSW	1	189653188	missense	probably benign
R8492:Cenpf	UTSW	1	189658729	missense	probably damaging	0.99
R8510:Cenpf	UTSW	1	189650706	missense	probably benign	0.01
R8686:Cenpf	UTSW	1	189659604	missense	probably benign	0.00
R8696:Cenpf	UTSW	1	189657997	missense	probably benign	0.20
R8855:Cenpf	UTSW	1	189653233	missense	probably benign	0.11
R8901:Cenpf	UTSW	1	189662051	missense	probably benign	0.30
R8958:Cenpf	UTSW	1	189653153	missense	possibly damaging	0.81
R9109:Cenpf	UTSW	1	189659374	missense	probably benign	0.06
R9135:Cenpf	UTSW	1	189672549	missense	probably damaging	1.00
R9136:Cenpf	UTSW	1	189671155	missense	probably benign	0.02
R9198:Cenpf	UTSW	1	189656790	missense	probably damaging	1.00
R9240:Cenpf	UTSW	1	189656970	missense	probably benign	0.01
R9303:Cenpf	UTSW	1	189660074	critical splice acceptor site	probably null
R9305:Cenpf	UTSW	1	189660074	critical splice acceptor site	probably null
R9354:Cenpf	UTSW	1	189646917	missense
R9502:Cenpf	UTSW	1	189656781	missense	probably damaging	1.00
R9619:Cenpf	UTSW	1	189653768	missense	probably benign	0.01
RF006:Cenpf	UTSW	1	189657386	missense	probably damaging	1.00
X0025:Cenpf	UTSW	1	189653874	missense	possibly damaging	0.79
X0066:Cenpf	UTSW	1	189657929	missense	probably benign	0.23
Z1088:Cenpf	UTSW	1	189652931	missense	probably damaging	1.00
Z1176:Cenpf	UTSW	1	189659472	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCATCTTGCTAGCCTTG -3'
(R):5'- TTGACATATTGCTCCACAGTGTTC -3'

Sequencing Primer
(F):5'- GAAAAATAATCACTACCAAACGAGGG -3'
(R):5'- CTTAGCACAATGATTGTTGATC -3'

Posted On

2020-07-13