Incidental Mutation 'R8194:Gpsm1'
ID635329
Institutional Source Beutler Lab
Gene Symbol Gpsm1
Ensembl Gene ENSMUSG00000026930
Gene NameG-protein signalling modulator 1 (AGS3-like, C. elegans)
SynonymsAgs3, 1810037C22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8194 (G1)
Quality Score173.468
Status Validated
Chromosome2
Chromosomal Location26315515-26348237 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CT to CTT at 26327352 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000067964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066889] [ENSMUST00000066936] [ENSMUST00000078616] [ENSMUST00000114134] [ENSMUST00000127453]
Predicted Effect probably null
Transcript: ENSMUST00000066889
SMART Domains Protein: ENSMUSP00000067964
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
TPR 98 131 1.45e-1 SMART
TPR 138 171 7.06e-5 SMART
TPR 238 271 5.96e-3 SMART
TPR 278 311 1.47e-2 SMART
TPR 318 351 5.19e-3 SMART
TPR 358 391 1.33e0 SMART
GoLoco 525 547 7.38e-9 SMART
low complexity region 548 560 N/A INTRINSIC
GoLoco 578 600 4.24e-9 SMART
GoLoco 626 648 5.22e-9 SMART
GoLoco 660 682 3.58e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000066936
SMART Domains Protein: ENSMUSP00000065000
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
TPR 66 99 1.45e-1 SMART
TPR 106 139 7.06e-5 SMART
TPR 206 239 5.96e-3 SMART
TPR 246 279 1.47e-2 SMART
TPR 286 319 5.19e-3 SMART
TPR 326 359 1.33e0 SMART
GoLoco 493 515 7.38e-9 SMART
low complexity region 516 528 N/A INTRINSIC
GoLoco 546 568 4.24e-9 SMART
GoLoco 594 616 5.22e-9 SMART
GoLoco 628 650 3.58e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000078616
SMART Domains Protein: ENSMUSP00000077686
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
TPR 66 99 1.45e-1 SMART
TPR 106 139 7.06e-5 SMART
TPR 206 239 5.96e-3 SMART
TPR 246 279 1.47e-2 SMART
TPR 286 319 5.19e-3 SMART
TPR 326 359 1.33e0 SMART
GoLoco 433 455 7.38e-9 SMART
low complexity region 456 468 N/A INTRINSIC
GoLoco 486 508 4.24e-9 SMART
GoLoco 534 556 5.22e-9 SMART
GoLoco 568 590 3.58e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114134
SMART Domains Protein: ENSMUSP00000109769
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
GoLoco 56 78 7.38e-9 SMART
low complexity region 79 91 N/A INTRINSIC
GoLoco 109 131 4.24e-9 SMART
GoLoco 157 179 5.22e-9 SMART
GoLoco 191 213 3.58e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127453
Predicted Effect probably null
Transcript: ENSMUST00000145884
SMART Domains Protein: ENSMUSP00000115680
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
Blast:TPR 22 68 1e-9 BLAST
Pfam:TPR_1 82 107 2.3e-4 PFAM
Pfam:TPR_12 82 147 7.9e-12 PFAM
Pfam:TPR_7 84 119 1.4e-5 PFAM
Pfam:TPR_2 122 147 6.2e-4 PFAM
Pfam:TPR_8 123 146 1.4e-2 PFAM
Blast:TPR 150 183 4e-15 BLAST
GoLoco 317 339 7.38e-9 SMART
low complexity region 340 352 N/A INTRINSIC
GoLoco 370 392 4.24e-9 SMART
GoLoco 418 440 5.22e-9 SMART
GoLoco 452 474 3.58e-7 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] G-protein signaling modulators (GPSMs) play diverse functional roles through their interaction with G-protein subunits. This gene encodes a receptor-independent activator of G protein signaling, which is one of several factors that influence the basal activity of G-protein signaling systems. The protein contains seven tetratricopeptide repeats in its N-terminal half and four G-protein regulatory (GPR) motifs in its C-terminal half. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a lean phenotype, reduced fat mass, increased food consumption, increased nocturnal energy expenditure and altered blood pressure control mechanisms; surprisingly, their basal behavior and gross brain morphology remain normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230046K03Rik A G 10: 83,580,299 I818V possibly damaging Het
Arid4a T A 12: 71,060,115 Y320* probably null Het
Ash1l T A 3: 89,052,755 C2265S probably damaging Het
Atg4b T A 1: 93,785,972 C55* probably null Het
Cacna1s A T 1: 136,077,692 N405I probably benign Het
Capn11 A T 17: 45,633,399 D526E probably damaging Het
Ccdc188 A G 16: 18,218,380 R71G probably benign Het
Ccser2 G A 14: 36,896,263 R772W probably damaging Het
Cenpf T A 1: 189,682,403 E172D probably benign Het
Cep85 T C 4: 134,134,089 M627V probably null Het
Chd1 G A 17: 17,374,475 probably benign Het
Cnst A G 1: 179,610,194 H441R probably benign Het
Cyp2d11 G T 15: 82,390,437 T313N probably damaging Het
Cyp2g1 A G 7: 26,814,734 N255S possibly damaging Het
Dnah5 A G 15: 28,453,268 D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Lama4 A G 10: 39,078,720 S1090G probably damaging Het
Malrd1 A G 2: 15,925,120 D1479G unknown Het
Man2a2 T C 7: 80,361,018 K742E probably benign Het
Mapk8 A T 14: 33,382,284 S392T probably benign Het
Mark3 T C 12: 111,592,683 I53T probably damaging Het
Mcmdc2 A G 1: 9,916,642 I219V probably benign Het
Mlycd A T 8: 119,407,593 E278V probably benign Het
Muc2 G T 7: 141,704,252 C29F Het
Mup20 T C 4: 62,053,484 I77V probably benign Het
Myh3 A G 11: 67,092,002 E849G probably damaging Het
Nedd4 A G 9: 72,686,107 N154S probably damaging Het
Olfr397 A T 11: 73,965,414 I269F probably benign Het
Pcdh7 A T 5: 57,720,336 N411I probably damaging Het
Plekhm1 A G 11: 103,395,060 I183T possibly damaging Het
Prkar2a G A 9: 108,692,511 V19M probably damaging Het
Prss35 T G 9: 86,755,613 N145K possibly damaging Het
Ranbp2 T A 10: 58,455,925 D251E possibly damaging Het
Rnf169 C A 7: 99,926,444 V315F probably damaging Het
Slc32a1 T C 2: 158,613,841 Y139H probably damaging Het
Slc5a2 T C 7: 128,271,156 V522A probably benign Het
Slc6a6 A T 6: 91,740,971 Q297L probably damaging Het
Sos2 A C 12: 69,598,824 Y914D probably damaging Het
Spata1 G T 3: 146,489,859 T32N possibly damaging Het
Srcap C T 7: 127,539,197 R1180C probably damaging Het
St14 A T 9: 31,131,625 M1K probably null Het
Tcaf1 T C 6: 42,675,302 T749A probably benign Het
Tcp1 T C 17: 12,922,734 probably null Het
Tle6 A G 10: 81,591,054 V576A probably damaging Het
Ttc25 G A 11: 100,563,676 G429E probably benign Het
Usp17lc T A 7: 103,418,200 M234K probably benign Het
Zdhhc18 A G 4: 133,613,854 L236P probably damaging Het
Zfp266 T C 9: 20,500,314 D189G probably benign Het
Zfp474 A T 18: 52,639,157 D294V probably damaging Het
Zfp568 T C 7: 30,023,333 F568L probably damaging Het
Zfp93 A G 7: 24,276,054 K488R probably benign Het
Other mutations in Gpsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01803:Gpsm1 APN 2 26346909 missense probably damaging 1.00
IGL01826:Gpsm1 APN 2 26326302 missense probably damaging 0.98
IGL02281:Gpsm1 APN 2 26339626 splice site probably benign
IGL02730:Gpsm1 APN 2 26325378 missense probably benign 0.13
IGL02740:Gpsm1 APN 2 26340573 missense probably benign 0.43
IGL02749:Gpsm1 APN 2 26339675 missense probably damaging 0.99
IGL02982:Gpsm1 APN 2 26324859 missense probably damaging 1.00
R1271:Gpsm1 UTSW 2 26344672 missense probably damaging 0.99
R1639:Gpsm1 UTSW 2 26345187 missense probably damaging 1.00
R1766:Gpsm1 UTSW 2 26325383 missense probably damaging 1.00
R1854:Gpsm1 UTSW 2 26344713 missense probably damaging 1.00
R2900:Gpsm1 UTSW 2 26345162 missense probably benign 0.00
R2994:Gpsm1 UTSW 2 26319831 unclassified probably benign
R2995:Gpsm1 UTSW 2 26319831 unclassified probably benign
R2996:Gpsm1 UTSW 2 26319831 unclassified probably benign
R4227:Gpsm1 UTSW 2 26339626 splice site probably benign
R4391:Gpsm1 UTSW 2 26323997 missense probably damaging 1.00
R4413:Gpsm1 UTSW 2 26319831 unclassified probably benign
R4461:Gpsm1 UTSW 2 26319831 unclassified probably benign
R4469:Gpsm1 UTSW 2 26319831 unclassified probably benign
R4659:Gpsm1 UTSW 2 26319831 unclassified probably benign
R4786:Gpsm1 UTSW 2 26322481 missense probably benign 0.01
R5025:Gpsm1 UTSW 2 26319996 missense possibly damaging 0.90
R5057:Gpsm1 UTSW 2 26325357 missense probably damaging 0.96
R5171:Gpsm1 UTSW 2 26327464 intron probably benign
R5356:Gpsm1 UTSW 2 26340562 missense possibly damaging 0.73
R5417:Gpsm1 UTSW 2 26324033 critical splice donor site probably null
R5967:Gpsm1 UTSW 2 26340534 splice site probably null
R6153:Gpsm1 UTSW 2 26325413 missense probably benign 0.14
R6969:Gpsm1 UTSW 2 26340543 missense probably benign 0.01
R7006:Gpsm1 UTSW 2 26322560 missense probably damaging 1.00
R7819:Gpsm1 UTSW 2 26339693 missense probably damaging 0.98
R7867:Gpsm1 UTSW 2 26340436 missense probably benign 0.38
R8195:Gpsm1 UTSW 2 26324917 splice site probably null
RF017:Gpsm1 UTSW 2 26324872 missense probably damaging 1.00
Z1176:Gpsm1 UTSW 2 26327345 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CTCAGAAAGCCAAGGGTCTG -3'
(R):5'- GACCTACTCTGTGTCCTGAACTG -3'

Sequencing Primer
(F):5'- AAGGGTCTGAGGTCAGCC -3'
(R):5'- GTGTCCTGAACTGTCTCCC -3'
Posted On2020-07-13