Incidental Mutation 'R8194:Fcnb'
ID635330
Institutional Source Beutler Lab
Gene Symbol Fcnb
Ensembl Gene ENSMUSG00000026835
Gene Nameficolin B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8194 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location28076378-28084885 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 28078318 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 209 (S209N)
Ref Sequence ENSEMBL: ENSMUSP00000028179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028179] [ENSMUST00000117486] [ENSMUST00000135472]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028179
AA Change: S209N

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028179
Gene: ENSMUSG00000026835
AA Change: S209N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Collagen 39 99 1.1e-11 PFAM
FBG 101 314 1.78e-115 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117486
AA Change: S209N

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112625
Gene: ENSMUSG00000026835
AA Change: S209N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Collagen 39 99 6.7e-12 PFAM
FBG 101 250 1.33e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135472
SMART Domains Protein: ENSMUSP00000119098
Gene: ENSMUSG00000026835

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Collagen 38 81 5.3e-10 PFAM
internal_repeat_1 86 107 1.19e-5 PROSPERO
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ficolin family of proteins are characterized by the presence of a leader peptide, a short N-terminal segment, followed by a collagen-like region, and a C-terminal fibrinogen-like domain. The collagen-like and the fibrinogen-like domains are also found separately in other proteins such as complement protein C1q, C-type lectins known as collectins, and tenascins. However, all these proteins recognize different targets, and are functionally distinct. Ficolin 1 encoded by FCN1 is predominantly expressed in the peripheral blood leukocytes, and has been postulated to function as a plasma protein with elastin-binding activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to Streptococcus pneumoniae infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230046K03Rik A G 10: 83,580,299 I818V possibly damaging Het
Arid4a T A 12: 71,060,115 Y320* probably null Het
Ash1l T A 3: 89,052,755 C2265S probably damaging Het
Atg4b T A 1: 93,785,972 C55* probably null Het
Cacna1s A T 1: 136,077,692 N405I probably benign Het
Capn11 A T 17: 45,633,399 D526E probably damaging Het
Ccdc188 A G 16: 18,218,380 R71G probably benign Het
Ccser2 G A 14: 36,896,263 R772W probably damaging Het
Cenpf T A 1: 189,682,403 E172D probably benign Het
Cep85 T C 4: 134,134,089 M627V probably null Het
Chd1 G A 17: 17,374,475 probably benign Het
Cnst A G 1: 179,610,194 H441R probably benign Het
Cyp2d11 G T 15: 82,390,437 T313N probably damaging Het
Cyp2g1 A G 7: 26,814,734 N255S possibly damaging Het
Dnah5 A G 15: 28,453,268 D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Gpsm1 CT CTT 2: 26,327,352 probably null Het
Lama4 A G 10: 39,078,720 S1090G probably damaging Het
Malrd1 A G 2: 15,925,120 D1479G unknown Het
Man2a2 T C 7: 80,361,018 K742E probably benign Het
Mapk8 A T 14: 33,382,284 S392T probably benign Het
Mark3 T C 12: 111,592,683 I53T probably damaging Het
Mcmdc2 A G 1: 9,916,642 I219V probably benign Het
Mlycd A T 8: 119,407,593 E278V probably benign Het
Muc2 G T 7: 141,704,252 C29F Het
Mup20 T C 4: 62,053,484 I77V probably benign Het
Myh3 A G 11: 67,092,002 E849G probably damaging Het
Nedd4 A G 9: 72,686,107 N154S probably damaging Het
Olfr397 A T 11: 73,965,414 I269F probably benign Het
Pcdh7 A T 5: 57,720,336 N411I probably damaging Het
Plekhm1 A G 11: 103,395,060 I183T possibly damaging Het
Prkar2a G A 9: 108,692,511 V19M probably damaging Het
Prss35 T G 9: 86,755,613 N145K possibly damaging Het
Ranbp2 T A 10: 58,455,925 D251E possibly damaging Het
Rnf169 C A 7: 99,926,444 V315F probably damaging Het
Slc32a1 T C 2: 158,613,841 Y139H probably damaging Het
Slc5a2 T C 7: 128,271,156 V522A probably benign Het
Slc6a6 A T 6: 91,740,971 Q297L probably damaging Het
Sos2 A C 12: 69,598,824 Y914D probably damaging Het
Spata1 G T 3: 146,489,859 T32N possibly damaging Het
Srcap C T 7: 127,539,197 R1180C probably damaging Het
St14 A T 9: 31,131,625 M1K probably null Het
Tcaf1 T C 6: 42,675,302 T749A probably benign Het
Tcp1 T C 17: 12,922,734 probably null Het
Tle6 A G 10: 81,591,054 V576A probably damaging Het
Ttc25 G A 11: 100,563,676 G429E probably benign Het
Usp17lc T A 7: 103,418,200 M234K probably benign Het
Zdhhc18 A G 4: 133,613,854 L236P probably damaging Het
Zfp266 T C 9: 20,500,314 D189G probably benign Het
Zfp474 A T 18: 52,639,157 D294V probably damaging Het
Zfp568 T C 7: 30,023,333 F568L probably damaging Het
Zfp93 A G 7: 24,276,054 K488R probably benign Het
Other mutations in Fcnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Fcnb APN 2 28076801 missense probably benign 0.04
IGL02130:Fcnb APN 2 28084789 critical splice donor site probably null
IGL02348:Fcnb APN 2 28084830 missense possibly damaging 0.88
IGL02504:Fcnb APN 2 28076594 missense probably damaging 1.00
IGL03118:Fcnb APN 2 28076618 missense probably benign 0.06
IGL03179:Fcnb APN 2 28076634 missense possibly damaging 0.93
R0217:Fcnb UTSW 2 28079677 missense probably benign 0.02
R0899:Fcnb UTSW 2 28076779 missense probably damaging 1.00
R3901:Fcnb UTSW 2 28079196 missense probably damaging 1.00
R5845:Fcnb UTSW 2 28079621 critical splice donor site probably null
R5911:Fcnb UTSW 2 28076689 missense probably damaging 1.00
R6065:Fcnb UTSW 2 28079910 missense probably damaging 1.00
R6188:Fcnb UTSW 2 28079190 missense possibly damaging 0.94
R6488:Fcnb UTSW 2 28078289 missense probably damaging 1.00
R8058:Fcnb UTSW 2 28079695 missense probably damaging 1.00
R8195:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8196:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8198:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8199:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
X0024:Fcnb UTSW 2 28076691 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCGCTGATGTCAACCCTAGG -3'
(R):5'- AAAGATGTTGGTACCTACCCCGG -3'

Sequencing Primer
(F):5'- TGATGTCAACCCTAGGCTCAAGG -3'
(R):5'- CCCGGTGAATTCCAAGTTCAG -3'
Posted On2020-07-13