Mutagenetix > Incidental Mutation

Incidental Mutation 'R8194:Ash1l'

635332

Institutional Source

Beutler Lab

Gene Symbol

Ash1l

Ensembl Gene

ENSMUSG00000028053

Gene Name

ASH1 like histone lysine methyltransferase

Synonyms

chromatin remodeling factor, E430018P19Rik, KMT2H, 8030453L17Rik

MMRRC Submission

Accession Numbers

Genbank: NM_138679; MGI: 2183158

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8194 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

88950622-89079375 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 89052755 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 2265 (C2265S)

Ref Sequence

ENSEMBL: ENSMUSP00000088451 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090933] [ENSMUST00000186583]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000090933
AA Change: C2265S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000088451
Gene: ENSMUSG00000028053
AA Change: C2265S

Domain	Start	End	E-Value	Type
low complexity region	36	46	N/A	INTRINSIC
low complexity region	226	237	N/A	INTRINSIC
internal_repeat_1	238	306	6.88e-12	PROSPERO
internal_repeat_1	306	406	6.88e-12	PROSPERO
low complexity region	552	571	N/A	INTRINSIC
low complexity region	706	717	N/A	INTRINSIC
low complexity region	745	753	N/A	INTRINSIC
low complexity region	777	791	N/A	INTRINSIC
AT_hook	823	835	3.06e2	SMART
low complexity region	859	873	N/A	INTRINSIC
AT_hook	885	897	9.15e0	SMART
low complexity region	938	948	N/A	INTRINSIC
low complexity region	1086	1105	N/A	INTRINSIC
low complexity region	1107	1121	N/A	INTRINSIC
low complexity region	1159	1173	N/A	INTRINSIC
low complexity region	1262	1273	N/A	INTRINSIC
low complexity region	1288	1301	N/A	INTRINSIC
AT_hook	1345	1357	3.09e-1	SMART
low complexity region	1377	1388	N/A	INTRINSIC
low complexity region	1395	1424	N/A	INTRINSIC
low complexity region	1478	1491	N/A	INTRINSIC
low complexity region	1678	1692	N/A	INTRINSIC
AT_hook	1843	1855	1.03e1	SMART
low complexity region	1971	1983	N/A	INTRINSIC
AWS	2081	2133	3.95e-26	SMART
SET	2135	2257	8.04e-45	SMART
PostSET	2259	2275	6.38e-2	SMART
low complexity region	2296	2316	N/A	INTRINSIC
BROMO	2431	2541	8.29e-23	SMART
low complexity region	2549	2563	N/A	INTRINSIC
PHD	2576	2618	8.25e-6	SMART
BAH	2650	2787	1.18e-23	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000186583
AA Change: C2265S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140251
Gene: ENSMUSG00000028053
AA Change: C2265S

Domain	Start	End	E-Value	Type
low complexity region	36	46	N/A	INTRINSIC
low complexity region	226	237	N/A	INTRINSIC
internal_repeat_1	238	306	6.88e-12	PROSPERO
internal_repeat_1	306	406	6.88e-12	PROSPERO
low complexity region	552	571	N/A	INTRINSIC
low complexity region	706	717	N/A	INTRINSIC
low complexity region	745	753	N/A	INTRINSIC
low complexity region	777	791	N/A	INTRINSIC
AT_hook	823	835	3.06e2	SMART
low complexity region	859	873	N/A	INTRINSIC
AT_hook	885	897	9.15e0	SMART
low complexity region	938	948	N/A	INTRINSIC
low complexity region	1086	1105	N/A	INTRINSIC
low complexity region	1107	1121	N/A	INTRINSIC
low complexity region	1159	1173	N/A	INTRINSIC
low complexity region	1262	1273	N/A	INTRINSIC
low complexity region	1288	1301	N/A	INTRINSIC
AT_hook	1345	1357	3.09e-1	SMART
low complexity region	1377	1388	N/A	INTRINSIC
low complexity region	1395	1424	N/A	INTRINSIC
low complexity region	1478	1491	N/A	INTRINSIC
low complexity region	1678	1692	N/A	INTRINSIC
AT_hook	1843	1855	1.03e1	SMART
low complexity region	1971	1983	N/A	INTRINSIC
AWS	2081	2133	3.95e-26	SMART
SET	2135	2257	8.04e-45	SMART
PostSET	2259	2275	6.38e-2	SMART
low complexity region	2296	2316	N/A	INTRINSIC
BROMO	2431	2541	8.29e-23	SMART
low complexity region	2549	2563	N/A	INTRINSIC
PHD	2576	2618	8.25e-6	SMART
BAH	2650	2787	1.18e-23	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trithorax group of transcriptional activators. The protein contains four AT hooks, a SET domain, a PHD-finger motif, and a bromodomain. It is localized to many small speckles in the nucleus, and also to cell-cell tight junctions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a transposon-induced allele are more susceptible to endotoxin shock, sepsis, and autoimmune disease. Homozygotes for a hypomorphic allele show reduced growth and postnatal lethality; surviving adults lack Meibomian glands and show vertebral, reproductive organ, and fertility defects. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arid4a	T	A	12: 71,060,115	Y320*	probably null	Het
Atg4b	T	A	1: 93,785,972	C55*	probably null	Het
Cacna1s	A	T	1: 136,077,692	N405I	probably benign	Het
Capn11	A	T	17: 45,633,399	D526E	probably damaging	Het
Ccdc188	A	G	16: 18,218,380	R71G	probably benign	Het
Ccser2	G	A	14: 36,896,263	R772W	probably damaging	Het
Cenpf	T	A	1: 189,682,403	E172D	probably benign	Het
Cep85	T	C	4: 134,134,089	M627V	probably null	Het
Chd1	G	A	17: 17,374,475		probably benign	Het
Cnst	A	G	1: 179,610,194	H441R	probably benign	Het
Cyp2d11	G	T	15: 82,390,437	T313N	probably damaging	Het
Cyp2g1	A	G	7: 26,814,734	N255S	possibly damaging	Het
Dnah5	A	G	15: 28,453,268	D4395G	probably damaging	Het
Fam83h	ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT	ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT	15: 76,002,775		probably benign	Het
Fcnb	C	T	2: 28,078,318	S209N	possibly damaging	Het
Gpsm1	CT	CTT	2: 26,327,352		probably null	Het
Lama4	A	G	10: 39,078,720	S1090G	probably damaging	Het
Malrd1	A	G	2: 15,925,120	D1479G	unknown	Het
Man2a2	T	C	7: 80,361,018	K742E	probably benign	Het
Mapk8	A	T	14: 33,382,284	S392T	probably benign	Het
Mark3	T	C	12: 111,592,683	I53T	probably damaging	Het
Mcmdc2	A	G	1: 9,916,642	I219V	probably benign	Het
Mlycd	A	T	8: 119,407,593	E278V	probably benign	Het
Muc2	G	T	7: 141,704,252	C29F		Het
Mup20	T	C	4: 62,053,484	I77V	probably benign	Het
Myh3	A	G	11: 67,092,002	E849G	probably damaging	Het
Nedd4	A	G	9: 72,686,107	N154S	probably damaging	Het
Olfr397	A	T	11: 73,965,414	I269F	probably benign	Het
Pcdh7	A	T	5: 57,720,336	N411I	probably damaging	Het
Plekhm1	A	G	11: 103,395,060	I183T	possibly damaging	Het
Prkar2a	G	A	9: 108,692,511	V19M	probably damaging	Het
Prss35	T	G	9: 86,755,613	N145K	possibly damaging	Het
Ranbp2	T	A	10: 58,455,925	D251E	possibly damaging	Het
Rnf169	C	A	7: 99,926,444	V315F	probably damaging	Het
Slc32a1	T	C	2: 158,613,841	Y139H	probably damaging	Het
Slc5a2	T	C	7: 128,271,156	V522A	probably benign	Het
Slc6a6	A	T	6: 91,740,971	Q297L	probably damaging	Het
Sos2	A	C	12: 69,598,824	Y914D	probably damaging	Het
Spata1	G	T	3: 146,489,859	T32N	possibly damaging	Het
Srcap	C	T	7: 127,539,197	R1180C	probably damaging	Het
St14	A	T	9: 31,131,625	M1K	probably null	Het
Tcaf1	T	C	6: 42,675,302	T749A	probably benign	Het
Tcp1	T	C	17: 12,922,734		probably null	Het
Tle6	A	G	10: 81,591,054	V576A	probably damaging	Het
Ttc25	G	A	11: 100,563,676	G429E	probably benign	Het
Usp17lc	T	A	7: 103,418,200	M234K	probably benign	Het
Washc4	A	G	10: 83,580,299	I818V	possibly damaging	Het
Zdhhc18	A	G	4: 133,613,854	L236P	probably damaging	Het
Zfp266	T	C	9: 20,500,314	D189G	probably benign	Het
Zfp474	A	T	18: 52,639,157	D294V	probably damaging	Het
Zfp568	T	C	7: 30,023,333	F568L	probably damaging	Het
Zfp93	A	G	7: 24,276,054	K488R	probably benign	Het

Other mutations in Ash1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Ash1l	APN	3	88981712	missense	probably benign	0.19
IGL00819:Ash1l	APN	3	89007736	missense	possibly damaging	0.68
IGL00939:Ash1l	APN	3	89035236	missense	probably damaging	0.99
IGL01064:Ash1l	APN	3	89072484	missense	probably damaging	1.00
IGL01066:Ash1l	APN	3	88984635	missense	probably damaging	1.00
IGL01087:Ash1l	APN	3	89063902	missense	probably damaging	1.00
IGL01293:Ash1l	APN	3	88983529	missense	probably benign	0.01
IGL01541:Ash1l	APN	3	89066265	missense	probably damaging	1.00
IGL01863:Ash1l	APN	3	88985506	nonsense	probably null
IGL02326:Ash1l	APN	3	88966057	missense	probably benign	0.00
IGL02407:Ash1l	APN	3	89072548	missense	probably damaging	1.00
IGL02419:Ash1l	APN	3	88985565	missense	probably benign	0.00
IGL02422:Ash1l	APN	3	89069079	critical splice donor site	probably null
IGL02494:Ash1l	APN	3	89066218	nonsense	probably null
IGL02727:Ash1l	APN	3	89023037	missense	probably benign
IGL02732:Ash1l	APN	3	88966228	missense	probably damaging	1.00
IGL02817:Ash1l	APN	3	88984801	missense	probably damaging	1.00
IGL02887:Ash1l	APN	3	88984181	missense	probably benign	0.11
IGL03224:Ash1l	APN	3	89035268	splice site	probably benign
IGL03253:Ash1l	APN	3	88984674	missense	probably damaging	1.00
IGL03327:Ash1l	APN	3	89023083	missense	probably benign	0.02
IGL03398:Ash1l	APN	3	89007220	missense	probably benign	0.01
3-1:Ash1l	UTSW	3	88966326	missense	probably benign
BB008:Ash1l	UTSW	3	89043541	missense	probably damaging	1.00
BB018:Ash1l	UTSW	3	89043541	missense	probably damaging	1.00
R0068:Ash1l	UTSW	3	89007317	missense	probably benign	0.17
R0068:Ash1l	UTSW	3	89007317	missense	probably benign	0.17
R0239:Ash1l	UTSW	3	89067222	missense	possibly damaging	0.49
R0239:Ash1l	UTSW	3	89067222	missense	possibly damaging	0.49
R0395:Ash1l	UTSW	3	89058589	missense	probably damaging	1.00
R0477:Ash1l	UTSW	3	88983459	missense	probably benign	0.41
R0528:Ash1l	UTSW	3	88982277	missense	probably benign
R0543:Ash1l	UTSW	3	89063778	splice site	probably null
R0855:Ash1l	UTSW	3	89054454	missense	possibly damaging	0.82
R1147:Ash1l	UTSW	3	88984887	missense	possibly damaging	0.72
R1147:Ash1l	UTSW	3	88984887	missense	possibly damaging	0.72
R1163:Ash1l	UTSW	3	89035263	critical splice donor site	probably null
R1196:Ash1l	UTSW	3	88983316	missense	probably damaging	0.99
R1419:Ash1l	UTSW	3	88984897	missense	probably damaging	0.99
R1445:Ash1l	UTSW	3	89007352	missense	probably benign	0.02
R1466:Ash1l	UTSW	3	89052065	missense	probably damaging	1.00
R1466:Ash1l	UTSW	3	89052065	missense	probably damaging	1.00
R1480:Ash1l	UTSW	3	88985052	missense	probably damaging	1.00
R1506:Ash1l	UTSW	3	89058499	missense	probably damaging	0.99
R1537:Ash1l	UTSW	3	89072476	missense	probably damaging	0.99
R1584:Ash1l	UTSW	3	89052065	missense	probably damaging	1.00
R1669:Ash1l	UTSW	3	89067242	critical splice donor site	probably null
R1713:Ash1l	UTSW	3	89076224	missense	probably damaging	1.00
R1780:Ash1l	UTSW	3	88965984	missense	probably benign
R1793:Ash1l	UTSW	3	89070309	missense	probably damaging	1.00
R1881:Ash1l	UTSW	3	88981555	missense	probably benign	0.00
R1909:Ash1l	UTSW	3	88984528	missense	probably benign	0.29
R1938:Ash1l	UTSW	3	88984422	missense	probably damaging	0.98
R2035:Ash1l	UTSW	3	89066317	missense	probably benign	0.00
R2070:Ash1l	UTSW	3	88966203	missense	probably damaging	1.00
R2071:Ash1l	UTSW	3	88966203	missense	probably damaging	1.00
R2114:Ash1l	UTSW	3	88983264	missense	probably benign	0.00
R2116:Ash1l	UTSW	3	88983264	missense	probably benign	0.00
R2118:Ash1l	UTSW	3	88985295	missense	possibly damaging	0.80
R2143:Ash1l	UTSW	3	88985419	missense	probably benign	0.09
R2164:Ash1l	UTSW	3	88985419	missense	probably benign	0.09
R2210:Ash1l	UTSW	3	89066298	missense	probably damaging	1.00
R2247:Ash1l	UTSW	3	89007367	missense	possibly damaging	0.77
R2303:Ash1l	UTSW	3	89026426	missense	probably damaging	1.00
R2860:Ash1l	UTSW	3	89054478	missense	probably damaging	1.00
R2861:Ash1l	UTSW	3	89054478	missense	probably damaging	1.00
R3104:Ash1l	UTSW	3	89054386	missense	probably damaging	1.00
R4133:Ash1l	UTSW	3	88982260	missense	probably benign	0.00
R4164:Ash1l	UTSW	3	88981966	missense	probably damaging	0.97
R4270:Ash1l	UTSW	3	88982040	missense	probably benign	0.26
R4271:Ash1l	UTSW	3	88982040	missense	probably benign	0.26
R4287:Ash1l	UTSW	3	89066415	missense	probably damaging	0.99
R4409:Ash1l	UTSW	3	89007199	missense	probably damaging	0.99
R4459:Ash1l	UTSW	3	88966234	missense	probably damaging	0.99
R4487:Ash1l	UTSW	3	88985315	missense	possibly damaging	0.65
R4674:Ash1l	UTSW	3	89072476	missense	possibly damaging	0.80
R4739:Ash1l	UTSW	3	88982845	missense	probably benign	0.19
R4927:Ash1l	UTSW	3	88985334	missense	probably damaging	1.00
R5000:Ash1l	UTSW	3	89058634	missense	probably damaging	1.00
R5016:Ash1l	UTSW	3	88982323	missense	probably damaging	1.00
R5055:Ash1l	UTSW	3	89023212	critical splice donor site	probably null
R5081:Ash1l	UTSW	3	88984717	missense	probably damaging	1.00
R5082:Ash1l	UTSW	3	88966234	missense	probably damaging	0.99
R5090:Ash1l	UTSW	3	89052877	missense	probably damaging	1.00
R5113:Ash1l	UTSW	3	89066275	missense	probably damaging	0.99
R5408:Ash1l	UTSW	3	88982394	missense	probably damaging	1.00
R5452:Ash1l	UTSW	3	88984876	missense	possibly damaging	0.93
R5487:Ash1l	UTSW	3	88981426	missense	probably benign	0.17
R5610:Ash1l	UTSW	3	89023185	missense	probably damaging	1.00
R5624:Ash1l	UTSW	3	88985609	missense	probably damaging	1.00
R5682:Ash1l	UTSW	3	89007607	missense	probably damaging	0.99
R5712:Ash1l	UTSW	3	89051990	missense	probably damaging	0.99
R5719:Ash1l	UTSW	3	89054498	missense	possibly damaging	0.83
R5719:Ash1l	UTSW	3	89058626	missense	probably damaging	1.00
R5839:Ash1l	UTSW	3	88983351	missense	probably damaging	0.99
R5859:Ash1l	UTSW	3	89068993	missense	probably damaging	1.00
R5877:Ash1l	UTSW	3	88981584	missense	probably benign	0.00
R5940:Ash1l	UTSW	3	88984036	missense	probably damaging	0.96
R6026:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6027:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6029:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6033:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6033:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6034:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6034:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6035:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6035:Ash1l	UTSW	3	88985019	missense	probably damaging	1.00
R6089:Ash1l	UTSW	3	89053143	nonsense	probably null
R6110:Ash1l	UTSW	3	88985129	missense	probably damaging	1.00
R6168:Ash1l	UTSW	3	89052773	nonsense	probably null
R6200:Ash1l	UTSW	3	89070527	missense	probably damaging	1.00
R6290:Ash1l	UTSW	3	88982761	nonsense	probably null
R6331:Ash1l	UTSW	3	89007865	missense	probably benign	0.00
R6425:Ash1l	UTSW	3	88983780	missense	probably damaging	0.99
R6540:Ash1l	UTSW	3	88985061	missense	probably damaging	1.00
R6568:Ash1l	UTSW	3	89052037	missense	probably benign	0.09
R6828:Ash1l	UTSW	3	89076113	missense	probably benign	0.00
R6843:Ash1l	UTSW	3	88985388	missense	probably damaging	1.00
R6894:Ash1l	UTSW	3	88982991	missense	probably benign	0.00
R6976:Ash1l	UTSW	3	88981657	missense	possibly damaging	0.77
R7038:Ash1l	UTSW	3	88982671	missense	probably benign	0.00
R7073:Ash1l	UTSW	3	88985340	missense	probably damaging	1.00
R7133:Ash1l	UTSW	3	88983457	frame shift	probably null
R7150:Ash1l	UTSW	3	89077074	missense	probably damaging	1.00
R7205:Ash1l	UTSW	3	88965952	missense	probably benign	0.00
R7254:Ash1l	UTSW	3	89070509	missense	probably damaging	1.00
R7272:Ash1l	UTSW	3	89054634	splice site	probably null
R7288:Ash1l	UTSW	3	88965892	start gained	probably benign
R7319:Ash1l	UTSW	3	88981387	missense	probably benign	0.19
R7341:Ash1l	UTSW	3	88981759	missense	possibly damaging	0.93
R7342:Ash1l	UTSW	3	88965997	missense	possibly damaging	0.94
R7454:Ash1l	UTSW	3	88983865	missense	probably benign	0.16
R7677:Ash1l	UTSW	3	89043193	missense	probably damaging	1.00
R7822:Ash1l	UTSW	3	89007264	missense	probably benign
R7857:Ash1l	UTSW	3	88984309	nonsense	probably null
R7889:Ash1l	UTSW	3	88966038	missense	probably benign	0.00
R7898:Ash1l	UTSW	3	88983625	missense	possibly damaging	0.54
R7931:Ash1l	UTSW	3	89043541	missense	probably damaging	1.00
R7937:Ash1l	UTSW	3	89070317	nonsense	probably null
R7973:Ash1l	UTSW	3	89052857	missense	probably benign
R8119:Ash1l	UTSW	3	89035427	missense	probably damaging	1.00
R8157:Ash1l	UTSW	3	89063707	critical splice donor site	probably null
R8162:Ash1l	UTSW	3	89070246	missense	probably damaging	0.99
R8306:Ash1l	UTSW	3	88965952	missense	probably benign	0.00
R8497:Ash1l	UTSW	3	89007644	missense	probably benign	0.02
R8558:Ash1l	UTSW	3	88984406	missense	probably damaging	0.96
R8744:Ash1l	UTSW	3	89058583	missense	possibly damaging	0.89
R8923:Ash1l	UTSW	3	88985667	missense	possibly damaging	0.51
R8969:Ash1l	UTSW	3	88966291	missense	possibly damaging	0.52
R8970:Ash1l	UTSW	3	89069000	missense	probably benign	0.00
R9002:Ash1l	UTSW	3	88981408	missense	probably benign	0.17
R9023:Ash1l	UTSW	3	88985269	missense	probably damaging	1.00
R9032:Ash1l	UTSW	3	88981987	missense	probably benign	0.19
R9032:Ash1l	UTSW	3	88984222	missense	probably benign	0.00
R9049:Ash1l	UTSW	3	89007364	missense	probably benign
R9085:Ash1l	UTSW	3	88981987	missense	probably benign	0.19
R9085:Ash1l	UTSW	3	88984222	missense	probably benign	0.00
R9130:Ash1l	UTSW	3	89058541	nonsense	probably null
R9149:Ash1l	UTSW	3	89007223	missense	probably benign
R9294:Ash1l	UTSW	3	88982990	missense	possibly damaging	0.90
R9365:Ash1l	UTSW	3	88981900	missense	possibly damaging	0.63
R9450:Ash1l	UTSW	3	89007832	missense	possibly damaging	0.86
R9542:Ash1l	UTSW	3	89043259	missense	probably damaging	1.00
R9558:Ash1l	UTSW	3	88982214	missense	probably benign	0.02
R9572:Ash1l	UTSW	3	89052881	missense	probably damaging	1.00
R9688:Ash1l	UTSW	3	88984717	missense	probably damaging	1.00
R9736:Ash1l	UTSW	3	88984426	missense	probably damaging	1.00
R9765:Ash1l	UTSW	3	89023193	missense	probably damaging	1.00
R9789:Ash1l	UTSW	3	88966066	missense	probably benign
X0017:Ash1l	UTSW	3	88984585	missense	probably benign	0.45
X0019:Ash1l	UTSW	3	89070556	missense	probably damaging	1.00
X0021:Ash1l	UTSW	3	88983204	missense	probably benign	0.10
Z1088:Ash1l	UTSW	3	88982709	missense	probably benign	0.00
Z1176:Ash1l	UTSW	3	89043217	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTTAGAGTCAGTTCCGCCCTC -3'
(R):5'- CGTGAGGTCTTGGTTTACCC -3'

Sequencing Primer
(F):5'- GTAAGGTGAACTCCAGATCTTCCTG -3'
(R):5'- CGTGAGGTCTTGGTTTACCCTTTTC -3'

Posted On

2020-07-13