Incidental Mutation 'R8194:Mup20'
ID 635334
Institutional Source Beutler Lab
Gene Symbol Mup20
Ensembl Gene ENSMUSG00000078672
Gene Name major urinary protein 20
Synonyms darcin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.033) question?
Stock # R8194 (G1)
Quality Score 194.009
Status Not validated
Chromosome 4
Chromosomal Location 62050234-62054158 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 62053484 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 77 (I77V)
Ref Sequence ENSEMBL: ENSMUSP00000073667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074018]
AlphaFold Q5FW60
PDB Structure Structural insights into the specificity of darcin, an atypical major urinary protein. [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000074018
AA Change: I77V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000073667
Gene: ENSMUSG00000078672
AA Change: I77V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Lipocalin 35 174 2.5e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230046K03Rik A G 10: 83,580,299 I818V possibly damaging Het
Arid4a T A 12: 71,060,115 Y320* probably null Het
Ash1l T A 3: 89,052,755 C2265S probably damaging Het
Atg4b T A 1: 93,785,972 C55* probably null Het
Cacna1s A T 1: 136,077,692 N405I probably benign Het
Capn11 A T 17: 45,633,399 D526E probably damaging Het
Ccdc188 A G 16: 18,218,380 R71G probably benign Het
Ccser2 G A 14: 36,896,263 R772W probably damaging Het
Cenpf T A 1: 189,682,403 E172D probably benign Het
Cep85 T C 4: 134,134,089 M627V probably null Het
Chd1 G A 17: 17,374,475 probably benign Het
Cnst A G 1: 179,610,194 H441R probably benign Het
Cyp2d11 G T 15: 82,390,437 T313N probably damaging Het
Cyp2g1 A G 7: 26,814,734 N255S possibly damaging Het
Dnah5 A G 15: 28,453,268 D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,327,352 probably null Het
Lama4 A G 10: 39,078,720 S1090G probably damaging Het
Malrd1 A G 2: 15,925,120 D1479G unknown Het
Man2a2 T C 7: 80,361,018 K742E probably benign Het
Mapk8 A T 14: 33,382,284 S392T probably benign Het
Mark3 T C 12: 111,592,683 I53T probably damaging Het
Mcmdc2 A G 1: 9,916,642 I219V probably benign Het
Mlycd A T 8: 119,407,593 E278V probably benign Het
Muc2 G T 7: 141,704,252 C29F Het
Myh3 A G 11: 67,092,002 E849G probably damaging Het
Nedd4 A G 9: 72,686,107 N154S probably damaging Het
Olfr397 A T 11: 73,965,414 I269F probably benign Het
Pcdh7 A T 5: 57,720,336 N411I probably damaging Het
Plekhm1 A G 11: 103,395,060 I183T possibly damaging Het
Prkar2a G A 9: 108,692,511 V19M probably damaging Het
Prss35 T G 9: 86,755,613 N145K possibly damaging Het
Ranbp2 T A 10: 58,455,925 D251E possibly damaging Het
Rnf169 C A 7: 99,926,444 V315F probably damaging Het
Slc32a1 T C 2: 158,613,841 Y139H probably damaging Het
Slc5a2 T C 7: 128,271,156 V522A probably benign Het
Slc6a6 A T 6: 91,740,971 Q297L probably damaging Het
Sos2 A C 12: 69,598,824 Y914D probably damaging Het
Spata1 G T 3: 146,489,859 T32N possibly damaging Het
Srcap C T 7: 127,539,197 R1180C probably damaging Het
St14 A T 9: 31,131,625 M1K probably null Het
Tcaf1 T C 6: 42,675,302 T749A probably benign Het
Tcp1 T C 17: 12,922,734 probably null Het
Tle6 A G 10: 81,591,054 V576A probably damaging Het
Ttc25 G A 11: 100,563,676 G429E probably benign Het
Usp17lc T A 7: 103,418,200 M234K probably benign Het
Zdhhc18 A G 4: 133,613,854 L236P probably damaging Het
Zfp266 T C 9: 20,500,314 D189G probably benign Het
Zfp474 A T 18: 52,639,157 D294V probably damaging Het
Zfp568 T C 7: 30,023,333 F568L probably damaging Het
Zfp93 A G 7: 24,276,054 K488R probably benign Het
Other mutations in Mup20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02465:Mup20 APN 4 62052000 missense possibly damaging 0.89
IGL02604:Mup20 APN 4 62051904 missense probably damaging 0.98
R5207:Mup20 UTSW 4 62051586 splice site probably null
R6173:Mup20 UTSW 4 62054030 missense unknown
R8364:Mup20 UTSW 4 62051531 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATCTAGATTTAGTGTCACATGGAGC -3'
(R):5'- GTGTATGCTCAGGCCCTAAC -3'

Sequencing Primer
(F):5'- AGTGTCACATGGAGCATTCTAG -3'
(R):5'- GAAATATGCATGTGGTATCCCTGCTC -3'
Posted On 2020-07-13