Incidental Mutation 'R8194:Cep85'
ID 635336
Institutional Source Beutler Lab
Gene Symbol Cep85
Ensembl Gene ENSMUSG00000037443
Gene Name centrosomal protein 85
Synonyms Ccdc21, 2410030J07Rik
MMRRC Submission 067617-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.943) question?
Stock # R8194 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 133857169-133914420 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 133861400 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 627 (M627V)
Ref Sequence ENSEMBL: ENSMUSP00000039889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040271] [ENSMUST00000121566]
AlphaFold Q8BMK0
Predicted Effect probably null
Transcript: ENSMUST00000040271
AA Change: M627V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039889
Gene: ENSMUSG00000037443
AA Change: M627V

DomainStartEndE-ValueType
coiled coil region 333 656 N/A INTRINSIC
coiled coil region 725 749 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121566
AA Change: M625V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113351
Gene: ENSMUSG00000037443
AA Change: M625V

DomainStartEndE-ValueType
coiled coil region 331 654 N/A INTRINSIC
coiled coil region 723 747 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the centrosome-associated family of proteins. The centrosome is a subcellular organelle in the animal cell that functions as a microtubule organizing center and is involved in cell-cycle progression. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4a T A 12: 71,106,889 (GRCm39) Y320* probably null Het
Ash1l T A 3: 88,960,062 (GRCm39) C2265S probably damaging Het
Atg4b T A 1: 93,713,694 (GRCm39) C55* probably null Het
Cacna1s A T 1: 136,005,430 (GRCm39) N405I probably benign Het
Capn11 A T 17: 45,944,325 (GRCm39) D526E probably damaging Het
Ccdc188 A G 16: 18,036,244 (GRCm39) R71G probably benign Het
Ccser2 G A 14: 36,618,220 (GRCm39) R772W probably damaging Het
Cenpf T A 1: 189,414,600 (GRCm39) E172D probably benign Het
Chd1 G A 17: 17,594,737 (GRCm39) probably benign Het
Cnst A G 1: 179,437,759 (GRCm39) H441R probably benign Het
Cyp2d11 G T 15: 82,274,638 (GRCm39) T313N probably damaging Het
Cyp2g1 A G 7: 26,514,159 (GRCm39) N255S possibly damaging Het
Dnah5 A G 15: 28,453,414 (GRCm39) D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 75,874,624 (GRCm39) probably benign Het
Fcnb C T 2: 27,968,330 (GRCm39) S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,217,364 (GRCm39) probably null Het
Lama4 A G 10: 38,954,716 (GRCm39) S1090G probably damaging Het
Malrd1 A G 2: 15,929,931 (GRCm39) D1479G unknown Het
Man2a2 T C 7: 80,010,766 (GRCm39) K742E probably benign Het
Mapk8 A T 14: 33,104,241 (GRCm39) S392T probably benign Het
Mark3 T C 12: 111,559,117 (GRCm39) I53T probably damaging Het
Mcmdc2 A G 1: 9,986,867 (GRCm39) I219V probably benign Het
Mlycd A T 8: 120,134,332 (GRCm39) E278V probably benign Het
Muc2 G T 7: 141,290,801 (GRCm39) C29F Het
Mup20 T C 4: 61,971,721 (GRCm39) I77V probably benign Het
Myh3 A G 11: 66,982,828 (GRCm39) E849G probably damaging Het
Nedd4 A G 9: 72,593,389 (GRCm39) N154S probably damaging Het
Odad4 G A 11: 100,454,502 (GRCm39) G429E probably benign Het
Or1e1f A T 11: 73,856,240 (GRCm39) I269F probably benign Het
Pcdh7 A T 5: 57,877,678 (GRCm39) N411I probably damaging Het
Plekhm1 A G 11: 103,285,886 (GRCm39) I183T possibly damaging Het
Prkar2a G A 9: 108,569,710 (GRCm39) V19M probably damaging Het
Prss35 T G 9: 86,637,666 (GRCm39) N145K possibly damaging Het
Ranbp2 T A 10: 58,291,747 (GRCm39) D251E possibly damaging Het
Rnf169 C A 7: 99,575,651 (GRCm39) V315F probably damaging Het
Slc32a1 T C 2: 158,455,761 (GRCm39) Y139H probably damaging Het
Slc5a2 T C 7: 127,870,328 (GRCm39) V522A probably benign Het
Slc6a6 A T 6: 91,717,952 (GRCm39) Q297L probably damaging Het
Sos2 A C 12: 69,645,598 (GRCm39) Y914D probably damaging Het
Spata1 G T 3: 146,195,614 (GRCm39) T32N possibly damaging Het
Srcap C T 7: 127,138,369 (GRCm39) R1180C probably damaging Het
St14 A T 9: 31,042,921 (GRCm39) M1K probably null Het
Tcaf1 T C 6: 42,652,236 (GRCm39) T749A probably benign Het
Tcp1 T C 17: 13,141,621 (GRCm39) probably null Het
Tle6 A G 10: 81,426,888 (GRCm39) V576A probably damaging Het
Usp17lc T A 7: 103,067,407 (GRCm39) M234K probably benign Het
Washc4 A G 10: 83,416,163 (GRCm39) I818V possibly damaging Het
Zdhhc18 A G 4: 133,341,165 (GRCm39) L236P probably damaging Het
Zfp266 T C 9: 20,411,610 (GRCm39) D189G probably benign Het
Zfp474 A T 18: 52,772,229 (GRCm39) D294V probably damaging Het
Zfp568 T C 7: 29,722,758 (GRCm39) F568L probably damaging Het
Zfp93 A G 7: 23,975,479 (GRCm39) K488R probably benign Het
Other mutations in Cep85
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Cep85 APN 4 133,876,072 (GRCm39) missense possibly damaging 0.63
IGL01397:Cep85 APN 4 133,883,517 (GRCm39) missense probably damaging 1.00
IGL01472:Cep85 APN 4 133,861,477 (GRCm39) missense possibly damaging 0.55
IGL01522:Cep85 APN 4 133,879,567 (GRCm39) missense probably damaging 1.00
IGL01522:Cep85 APN 4 133,879,566 (GRCm39) missense probably damaging 1.00
IGL02004:Cep85 APN 4 133,894,698 (GRCm39) missense probably damaging 1.00
IGL02043:Cep85 APN 4 133,883,038 (GRCm39) missense probably benign 0.02
IGL02187:Cep85 APN 4 133,858,616 (GRCm39) missense possibly damaging 0.86
IGL02317:Cep85 APN 4 133,883,122 (GRCm39) missense probably damaging 1.00
IGL02543:Cep85 APN 4 133,883,634 (GRCm39) missense possibly damaging 0.52
1mM(1):Cep85 UTSW 4 133,883,575 (GRCm39) missense possibly damaging 0.88
PIT4468001:Cep85 UTSW 4 133,876,008 (GRCm39) missense probably damaging 1.00
R0060:Cep85 UTSW 4 133,894,611 (GRCm39) missense probably damaging 1.00
R0068:Cep85 UTSW 4 133,881,606 (GRCm39) missense probably benign 0.00
R0346:Cep85 UTSW 4 133,859,733 (GRCm39) missense probably damaging 1.00
R0462:Cep85 UTSW 4 133,858,732 (GRCm39) missense possibly damaging 0.88
R1295:Cep85 UTSW 4 133,894,711 (GRCm39) missense probably damaging 1.00
R1296:Cep85 UTSW 4 133,894,711 (GRCm39) missense probably damaging 1.00
R1472:Cep85 UTSW 4 133,894,711 (GRCm39) missense probably damaging 1.00
R1577:Cep85 UTSW 4 133,879,599 (GRCm39) missense probably damaging 1.00
R1681:Cep85 UTSW 4 133,876,039 (GRCm39) nonsense probably null
R1687:Cep85 UTSW 4 133,875,324 (GRCm39) missense probably benign 0.00
R2031:Cep85 UTSW 4 133,859,761 (GRCm39) missense probably benign 0.00
R2216:Cep85 UTSW 4 133,858,741 (GRCm39) missense possibly damaging 0.62
R2220:Cep85 UTSW 4 133,881,178 (GRCm39) missense probably damaging 1.00
R4321:Cep85 UTSW 4 133,859,596 (GRCm39) missense probably damaging 1.00
R4888:Cep85 UTSW 4 133,892,062 (GRCm39) intron probably benign
R5044:Cep85 UTSW 4 133,883,490 (GRCm39) missense probably damaging 0.97
R5075:Cep85 UTSW 4 133,859,678 (GRCm39) missense probably damaging 1.00
R5627:Cep85 UTSW 4 133,861,408 (GRCm39) missense probably damaging 1.00
R6841:Cep85 UTSW 4 133,883,167 (GRCm39) missense probably benign
R6842:Cep85 UTSW 4 133,883,167 (GRCm39) missense probably benign
R6843:Cep85 UTSW 4 133,883,167 (GRCm39) missense probably benign
R6981:Cep85 UTSW 4 133,879,572 (GRCm39) missense probably damaging 1.00
R7252:Cep85 UTSW 4 133,875,342 (GRCm39) missense probably benign 0.12
R7869:Cep85 UTSW 4 133,859,609 (GRCm39) missense probably damaging 0.99
R8057:Cep85 UTSW 4 133,880,925 (GRCm39) unclassified probably benign
R8733:Cep85 UTSW 4 133,875,472 (GRCm39) missense possibly damaging 0.87
R8928:Cep85 UTSW 4 133,859,715 (GRCm39) missense probably benign 0.00
R9430:Cep85 UTSW 4 133,894,665 (GRCm39) missense probably damaging 1.00
R9550:Cep85 UTSW 4 133,858,598 (GRCm39) missense probably damaging 1.00
V8831:Cep85 UTSW 4 133,883,380 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATGGCCACTCTCAGACAAGC -3'
(R):5'- ATGGAATGTAGCGGCTCTCAG -3'

Sequencing Primer
(F):5'- ACTCTCAGACAAGCCTAGGG -3'
(R):5'- TCTCAGCCCTTAGAGCAGCTG -3'
Posted On 2020-07-13