Incidental Mutation 'R8194:Cep85'
ID 635336
Institutional Source Beutler Lab
Gene Symbol Cep85
Ensembl Gene ENSMUSG00000037443
Gene Name centrosomal protein 85
Synonyms 2410030J07Rik, Ccdc21
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock # R8194 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 134129858-134187112 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 134134089 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 627 (M627V)
Ref Sequence ENSEMBL: ENSMUSP00000039889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040271] [ENSMUST00000121566]
AlphaFold Q8BMK0
Predicted Effect probably null
Transcript: ENSMUST00000040271
AA Change: M627V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039889
Gene: ENSMUSG00000037443
AA Change: M627V

DomainStartEndE-ValueType
coiled coil region 333 656 N/A INTRINSIC
coiled coil region 725 749 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121566
AA Change: M625V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113351
Gene: ENSMUSG00000037443
AA Change: M625V

DomainStartEndE-ValueType
coiled coil region 331 654 N/A INTRINSIC
coiled coil region 723 747 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the centrosome-associated family of proteins. The centrosome is a subcellular organelle in the animal cell that functions as a microtubule organizing center and is involved in cell-cycle progression. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230046K03Rik A G 10: 83,580,299 I818V possibly damaging Het
Arid4a T A 12: 71,060,115 Y320* probably null Het
Ash1l T A 3: 89,052,755 C2265S probably damaging Het
Atg4b T A 1: 93,785,972 C55* probably null Het
Cacna1s A T 1: 136,077,692 N405I probably benign Het
Capn11 A T 17: 45,633,399 D526E probably damaging Het
Ccdc188 A G 16: 18,218,380 R71G probably benign Het
Ccser2 G A 14: 36,896,263 R772W probably damaging Het
Cenpf T A 1: 189,682,403 E172D probably benign Het
Chd1 G A 17: 17,374,475 probably benign Het
Cnst A G 1: 179,610,194 H441R probably benign Het
Cyp2d11 G T 15: 82,390,437 T313N probably damaging Het
Cyp2g1 A G 7: 26,814,734 N255S possibly damaging Het
Dnah5 A G 15: 28,453,268 D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,327,352 probably null Het
Lama4 A G 10: 39,078,720 S1090G probably damaging Het
Malrd1 A G 2: 15,925,120 D1479G unknown Het
Man2a2 T C 7: 80,361,018 K742E probably benign Het
Mapk8 A T 14: 33,382,284 S392T probably benign Het
Mark3 T C 12: 111,592,683 I53T probably damaging Het
Mcmdc2 A G 1: 9,916,642 I219V probably benign Het
Mlycd A T 8: 119,407,593 E278V probably benign Het
Muc2 G T 7: 141,704,252 C29F Het
Mup20 T C 4: 62,053,484 I77V probably benign Het
Myh3 A G 11: 67,092,002 E849G probably damaging Het
Nedd4 A G 9: 72,686,107 N154S probably damaging Het
Olfr397 A T 11: 73,965,414 I269F probably benign Het
Pcdh7 A T 5: 57,720,336 N411I probably damaging Het
Plekhm1 A G 11: 103,395,060 I183T possibly damaging Het
Prkar2a G A 9: 108,692,511 V19M probably damaging Het
Prss35 T G 9: 86,755,613 N145K possibly damaging Het
Ranbp2 T A 10: 58,455,925 D251E possibly damaging Het
Rnf169 C A 7: 99,926,444 V315F probably damaging Het
Slc32a1 T C 2: 158,613,841 Y139H probably damaging Het
Slc5a2 T C 7: 128,271,156 V522A probably benign Het
Slc6a6 A T 6: 91,740,971 Q297L probably damaging Het
Sos2 A C 12: 69,598,824 Y914D probably damaging Het
Spata1 G T 3: 146,489,859 T32N possibly damaging Het
Srcap C T 7: 127,539,197 R1180C probably damaging Het
St14 A T 9: 31,131,625 M1K probably null Het
Tcaf1 T C 6: 42,675,302 T749A probably benign Het
Tcp1 T C 17: 12,922,734 probably null Het
Tle6 A G 10: 81,591,054 V576A probably damaging Het
Ttc25 G A 11: 100,563,676 G429E probably benign Het
Usp17lc T A 7: 103,418,200 M234K probably benign Het
Zdhhc18 A G 4: 133,613,854 L236P probably damaging Het
Zfp266 T C 9: 20,500,314 D189G probably benign Het
Zfp474 A T 18: 52,639,157 D294V probably damaging Het
Zfp568 T C 7: 30,023,333 F568L probably damaging Het
Zfp93 A G 7: 24,276,054 K488R probably benign Het
Other mutations in Cep85
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Cep85 APN 4 134148761 missense possibly damaging 0.63
IGL01397:Cep85 APN 4 134156206 missense probably damaging 1.00
IGL01472:Cep85 APN 4 134134166 missense possibly damaging 0.55
IGL01522:Cep85 APN 4 134152255 missense probably damaging 1.00
IGL01522:Cep85 APN 4 134152256 missense probably damaging 1.00
IGL02004:Cep85 APN 4 134167387 missense probably damaging 1.00
IGL02043:Cep85 APN 4 134155727 missense probably benign 0.02
IGL02187:Cep85 APN 4 134131305 missense possibly damaging 0.86
IGL02317:Cep85 APN 4 134155811 missense probably damaging 1.00
IGL02543:Cep85 APN 4 134156323 missense possibly damaging 0.52
1mM(1):Cep85 UTSW 4 134156264 missense possibly damaging 0.88
PIT4468001:Cep85 UTSW 4 134148697 missense probably damaging 1.00
R0060:Cep85 UTSW 4 134167300 missense probably damaging 1.00
R0068:Cep85 UTSW 4 134154295 missense probably benign 0.00
R0346:Cep85 UTSW 4 134132422 missense probably damaging 1.00
R0462:Cep85 UTSW 4 134131421 missense possibly damaging 0.88
R1295:Cep85 UTSW 4 134167400 missense probably damaging 1.00
R1296:Cep85 UTSW 4 134167400 missense probably damaging 1.00
R1472:Cep85 UTSW 4 134167400 missense probably damaging 1.00
R1577:Cep85 UTSW 4 134152288 missense probably damaging 1.00
R1681:Cep85 UTSW 4 134148728 nonsense probably null
R1687:Cep85 UTSW 4 134148013 missense probably benign 0.00
R2031:Cep85 UTSW 4 134132450 missense probably benign 0.00
R2216:Cep85 UTSW 4 134131430 missense possibly damaging 0.62
R2220:Cep85 UTSW 4 134153867 missense probably damaging 1.00
R4321:Cep85 UTSW 4 134132285 missense probably damaging 1.00
R4888:Cep85 UTSW 4 134164751 intron probably benign
R5044:Cep85 UTSW 4 134156179 missense probably damaging 0.97
R5075:Cep85 UTSW 4 134132367 missense probably damaging 1.00
R5627:Cep85 UTSW 4 134134097 missense probably damaging 1.00
R6841:Cep85 UTSW 4 134155856 missense probably benign
R6842:Cep85 UTSW 4 134155856 missense probably benign
R6843:Cep85 UTSW 4 134155856 missense probably benign
R6981:Cep85 UTSW 4 134152261 missense probably damaging 1.00
R7252:Cep85 UTSW 4 134148031 missense probably benign 0.12
R7869:Cep85 UTSW 4 134132298 missense probably damaging 0.99
R8057:Cep85 UTSW 4 134153614 unclassified probably benign
R8733:Cep85 UTSW 4 134148161 missense possibly damaging 0.87
R8928:Cep85 UTSW 4 134132404 missense probably benign 0.00
R9430:Cep85 UTSW 4 134167354 missense probably damaging 1.00
V8831:Cep85 UTSW 4 134156069 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATGGCCACTCTCAGACAAGC -3'
(R):5'- ATGGAATGTAGCGGCTCTCAG -3'

Sequencing Primer
(F):5'- ACTCTCAGACAAGCCTAGGG -3'
(R):5'- TCTCAGCCCTTAGAGCAGCTG -3'
Posted On 2020-07-13