Incidental Mutation 'R8194:Pcdh7'
ID635337
Institutional Source Beutler Lab
Gene Symbol Pcdh7
Ensembl Gene ENSMUSG00000029108
Gene Nameprotocadherin 7
SynonymsBH-protocadherin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R8194 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location57717967-58133230 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57720336 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 411 (N411I)
Ref Sequence ENSEMBL: ENSMUSP00000142319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068110] [ENSMUST00000094783] [ENSMUST00000191837] [ENSMUST00000199310]
Predicted Effect probably damaging
Transcript: ENSMUST00000068110
AA Change: N411I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066306
Gene: ENSMUSG00000029108
AA Change: N411I

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CA 48 141 7.29e-4 SMART
CA 165 306 1.13e-18 SMART
CA 330 413 2.12e-23 SMART
CA 445 533 1.53e-20 SMART
CA 557 637 1.36e-26 SMART
CA 661 740 2.38e-26 SMART
CA 766 847 2.01e-15 SMART
transmembrane domain 878 900 N/A INTRINSIC
low complexity region 929 944 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000092376
Gene: ENSMUSG00000029108
AA Change: N411I

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CA 48 141 7.29e-4 SMART
CA 165 306 1.13e-18 SMART
CA 330 413 2.12e-23 SMART
CA 445 533 1.53e-20 SMART
CA 557 637 1.36e-26 SMART
CA 661 740 2.38e-26 SMART
CA 766 847 2.01e-15 SMART
transmembrane domain 878 900 N/A INTRINSIC
low complexity region 929 944 N/A INTRINSIC
low complexity region 1088 1099 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191837
AA Change: N411I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142319
Gene: ENSMUSG00000029108
AA Change: N411I

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CA 48 141 7.29e-4 SMART
CA 165 306 1.13e-18 SMART
CA 330 413 2.12e-23 SMART
CA 445 533 1.53e-20 SMART
CA 557 637 1.36e-26 SMART
CA 661 740 2.38e-26 SMART
CA 766 847 2.01e-15 SMART
transmembrane domain 878 900 N/A INTRINSIC
low complexity region 929 944 N/A INTRINSIC
low complexity region 1088 1099 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192048
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000195156
Predicted Effect probably benign
Transcript: ENSMUST00000199310
SMART Domains Protein: ENSMUSP00000143387
Gene: ENSMUSG00000029108

DomainStartEndE-ValueType
Pfam:Protocadherin 1 79 5.1e-40 PFAM
low complexity region 112 123 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The gene encodes a protein with an extracellular domain containing 7 cadherin repeats. The gene product is an integral membrane protein that is thought to function in cell-cell recognition and adhesion. Alternative splicing yields isoforms with unique cytoplasmic tails. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230046K03Rik A G 10: 83,580,299 I818V possibly damaging Het
Arid4a T A 12: 71,060,115 Y320* probably null Het
Ash1l T A 3: 89,052,755 C2265S probably damaging Het
Atg4b T A 1: 93,785,972 C55* probably null Het
Cacna1s A T 1: 136,077,692 N405I probably benign Het
Capn11 A T 17: 45,633,399 D526E probably damaging Het
Ccdc188 A G 16: 18,218,380 R71G probably benign Het
Ccser2 G A 14: 36,896,263 R772W probably damaging Het
Cenpf T A 1: 189,682,403 E172D probably benign Het
Cep85 T C 4: 134,134,089 M627V probably null Het
Chd1 G A 17: 17,374,475 probably benign Het
Cnst A G 1: 179,610,194 H441R probably benign Het
Cyp2d11 G T 15: 82,390,437 T313N probably damaging Het
Cyp2g1 A G 7: 26,814,734 N255S possibly damaging Het
Dnah5 A G 15: 28,453,268 D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,327,352 probably null Het
Lama4 A G 10: 39,078,720 S1090G probably damaging Het
Malrd1 A G 2: 15,925,120 D1479G unknown Het
Man2a2 T C 7: 80,361,018 K742E probably benign Het
Mapk8 A T 14: 33,382,284 S392T probably benign Het
Mark3 T C 12: 111,592,683 I53T probably damaging Het
Mcmdc2 A G 1: 9,916,642 I219V probably benign Het
Mlycd A T 8: 119,407,593 E278V probably benign Het
Muc2 G T 7: 141,704,252 C29F Het
Mup20 T C 4: 62,053,484 I77V probably benign Het
Myh3 A G 11: 67,092,002 E849G probably damaging Het
Nedd4 A G 9: 72,686,107 N154S probably damaging Het
Olfr397 A T 11: 73,965,414 I269F probably benign Het
Plekhm1 A G 11: 103,395,060 I183T possibly damaging Het
Prkar2a G A 9: 108,692,511 V19M probably damaging Het
Prss35 T G 9: 86,755,613 N145K possibly damaging Het
Ranbp2 T A 10: 58,455,925 D251E possibly damaging Het
Rnf169 C A 7: 99,926,444 V315F probably damaging Het
Slc32a1 T C 2: 158,613,841 Y139H probably damaging Het
Slc5a2 T C 7: 128,271,156 V522A probably benign Het
Slc6a6 A T 6: 91,740,971 Q297L probably damaging Het
Sos2 A C 12: 69,598,824 Y914D probably damaging Het
Spata1 G T 3: 146,489,859 T32N possibly damaging Het
Srcap C T 7: 127,539,197 R1180C probably damaging Het
St14 A T 9: 31,131,625 M1K probably null Het
Tcaf1 T C 6: 42,675,302 T749A probably benign Het
Tcp1 T C 17: 12,922,734 probably null Het
Tle6 A G 10: 81,591,054 V576A probably damaging Het
Ttc25 G A 11: 100,563,676 G429E probably benign Het
Usp17lc T A 7: 103,418,200 M234K probably benign Het
Zdhhc18 A G 4: 133,613,854 L236P probably damaging Het
Zfp266 T C 9: 20,500,314 D189G probably benign Het
Zfp474 A T 18: 52,639,157 D294V probably damaging Het
Zfp568 T C 7: 30,023,333 F568L probably damaging Het
Zfp93 A G 7: 24,276,054 K488R probably benign Het
Other mutations in Pcdh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Pcdh7 APN 5 57721464 missense probably damaging 1.00
IGL00920:Pcdh7 APN 5 57720131 missense probably damaging 0.96
IGL00990:Pcdh7 APN 5 57720464 missense possibly damaging 0.94
IGL01367:Pcdh7 APN 5 58129224 missense possibly damaging 0.67
IGL01388:Pcdh7 APN 5 57720204 missense probably damaging 1.00
IGL01543:Pcdh7 APN 5 57720765 missense probably damaging 1.00
IGL01750:Pcdh7 APN 5 57720422 missense probably damaging 1.00
IGL02010:Pcdh7 APN 5 58129255 missense probably benign
IGL02014:Pcdh7 APN 5 57719703 missense probably benign 0.03
IGL02269:Pcdh7 APN 5 57913322 missense probably damaging 1.00
IGL03051:Pcdh7 APN 5 58129073 missense probably damaging 0.99
floated UTSW 5 57721362 missense probably damaging 1.00
proposed UTSW 5 57722240 missense probably damaging 0.99
P0037:Pcdh7 UTSW 5 57913248 missense probably benign 0.17
R0003:Pcdh7 UTSW 5 57913248 missense probably benign 0.17
R0421:Pcdh7 UTSW 5 57720060 missense probably damaging 1.00
R0551:Pcdh7 UTSW 5 57721994 missense probably damaging 0.99
R0562:Pcdh7 UTSW 5 57720063 missense probably damaging 0.99
R0732:Pcdh7 UTSW 5 57721315 missense probably damaging 1.00
R0755:Pcdh7 UTSW 5 57720322 missense possibly damaging 0.86
R1080:Pcdh7 UTSW 5 57719426 missense probably damaging 1.00
R1381:Pcdh7 UTSW 5 57721540 nonsense probably null
R1591:Pcdh7 UTSW 5 57720422 missense probably damaging 1.00
R1891:Pcdh7 UTSW 5 57720875 missense probably damaging 0.98
R2011:Pcdh7 UTSW 5 57719629 missense probably damaging 1.00
R2140:Pcdh7 UTSW 5 58128996 missense probably damaging 1.00
R2147:Pcdh7 UTSW 5 58129116 missense possibly damaging 0.51
R2848:Pcdh7 UTSW 5 57720276 missense probably damaging 1.00
R2867:Pcdh7 UTSW 5 57721894 missense probably damaging 1.00
R2867:Pcdh7 UTSW 5 57721894 missense probably damaging 1.00
R3719:Pcdh7 UTSW 5 58129032 missense probably damaging 1.00
R4075:Pcdh7 UTSW 5 57721808 missense probably damaging 1.00
R4231:Pcdh7 UTSW 5 57719289 missense possibly damaging 0.94
R4236:Pcdh7 UTSW 5 57719289 missense possibly damaging 0.94
R4352:Pcdh7 UTSW 5 57722019 missense possibly damaging 0.88
R4420:Pcdh7 UTSW 5 58129170 missense probably benign 0.03
R4449:Pcdh7 UTSW 5 57720485 missense probably damaging 1.00
R4584:Pcdh7 UTSW 5 57721283 missense probably damaging 1.00
R4686:Pcdh7 UTSW 5 58129169 missense probably benign
R4837:Pcdh7 UTSW 5 57720411 missense possibly damaging 0.89
R4838:Pcdh7 UTSW 5 57720804 missense probably damaging 1.00
R4947:Pcdh7 UTSW 5 57721916 missense probably damaging 0.98
R5053:Pcdh7 UTSW 5 57721601 missense probably damaging 0.99
R5068:Pcdh7 UTSW 5 57722166 missense probably damaging 1.00
R5117:Pcdh7 UTSW 5 57721748 missense probably benign 0.09
R5132:Pcdh7 UTSW 5 57728121 missense probably benign
R5248:Pcdh7 UTSW 5 58129173 missense probably damaging 0.97
R5294:Pcdh7 UTSW 5 57728111 splice site probably null
R5420:Pcdh7 UTSW 5 57720187 missense probably damaging 1.00
R5777:Pcdh7 UTSW 5 57719514 missense probably damaging 1.00
R5800:Pcdh7 UTSW 5 57722225 missense probably damaging 1.00
R5834:Pcdh7 UTSW 5 57721628 missense possibly damaging 0.90
R5870:Pcdh7 UTSW 5 57720411 missense possibly damaging 0.89
R5917:Pcdh7 UTSW 5 57721755 missense probably damaging 0.96
R6014:Pcdh7 UTSW 5 57721155 missense probably damaging 0.99
R6193:Pcdh7 UTSW 5 57720324 missense probably damaging 1.00
R6240:Pcdh7 UTSW 5 57721362 missense probably damaging 1.00
R6335:Pcdh7 UTSW 5 57942265 splice site probably null
R6418:Pcdh7 UTSW 5 57721704 missense probably damaging 1.00
R6907:Pcdh7 UTSW 5 57719129 missense possibly damaging 0.53
R7058:Pcdh7 UTSW 5 57722240 missense probably damaging 0.99
R7069:Pcdh7 UTSW 5 57719784 missense probably benign 0.00
R7073:Pcdh7 UTSW 5 57720957 missense probably benign 0.19
R7463:Pcdh7 UTSW 5 57720998 missense probably benign 0.06
R7509:Pcdh7 UTSW 5 57720187 missense probably damaging 1.00
R7588:Pcdh7 UTSW 5 57719904 missense probably damaging 1.00
R7707:Pcdh7 UTSW 5 57720330 missense probably damaging 0.99
R7734:Pcdh7 UTSW 5 57719634 missense probably damaging 0.99
R7899:Pcdh7 UTSW 5 57719810 missense probably benign
X0021:Pcdh7 UTSW 5 57721484 missense possibly damaging 0.95
X0026:Pcdh7 UTSW 5 57719379 missense probably damaging 1.00
Z1177:Pcdh7 UTSW 5 57719664 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCCACCGATTTGGATGTAGG -3'
(R):5'- AACGTCTCCCACTACGGTAC -3'

Sequencing Primer
(F):5'- ATGTATTTGGGGCTGCCACC -3'
(R):5'- TCTCCCACTACGGTACAGGTG -3'
Posted On2020-07-13