Incidental Mutation 'R8194:Tcaf1'
ID635338
Institutional Source Beutler Lab
Gene Symbol Tcaf1
Ensembl Gene ENSMUSG00000036667
Gene NameTRPM8 channel-associated factor 1
SynonymsA230020K05Rik, 2810407D09Rik, Fam115a, 3321401G04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R8194 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location42668002-42710088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42675302 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 749 (T749A)
Ref Sequence ENSEMBL: ENSMUSP00000046137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045054] [ENSMUST00000045140] [ENSMUST00000121083]
Predicted Effect probably benign
Transcript: ENSMUST00000045054
AA Change: T749A

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000046137
Gene: ENSMUSG00000036667
AA Change: T749A

DomainStartEndE-ValueType
internal_repeat_1 14 197 6.95e-30 PROSPERO
low complexity region 207 221 N/A INTRINSIC
internal_repeat_1 222 406 6.95e-30 PROSPERO
low complexity region 463 474 N/A INTRINSIC
M60-like 542 841 1.94e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000045140
AA Change: T749A

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000036379
Gene: ENSMUSG00000036667
AA Change: T749A

DomainStartEndE-ValueType
internal_repeat_1 14 197 6.95e-30 PROSPERO
low complexity region 207 221 N/A INTRINSIC
internal_repeat_1 222 406 6.95e-30 PROSPERO
low complexity region 463 474 N/A INTRINSIC
M60-like 542 841 1.94e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121083
AA Change: T749A

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000114036
Gene: ENSMUSG00000036667
AA Change: T749A

DomainStartEndE-ValueType
internal_repeat_1 14 197 6.95e-30 PROSPERO
low complexity region 207 221 N/A INTRINSIC
internal_repeat_1 222 406 6.95e-30 PROSPERO
low complexity region 463 474 N/A INTRINSIC
M60-like 542 841 1.94e-128 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230046K03Rik A G 10: 83,580,299 I818V possibly damaging Het
Arid4a T A 12: 71,060,115 Y320* probably null Het
Ash1l T A 3: 89,052,755 C2265S probably damaging Het
Atg4b T A 1: 93,785,972 C55* probably null Het
Cacna1s A T 1: 136,077,692 N405I probably benign Het
Capn11 A T 17: 45,633,399 D526E probably damaging Het
Ccdc188 A G 16: 18,218,380 R71G probably benign Het
Ccser2 G A 14: 36,896,263 R772W probably damaging Het
Cenpf T A 1: 189,682,403 E172D probably benign Het
Cep85 T C 4: 134,134,089 M627V probably null Het
Chd1 G A 17: 17,374,475 probably benign Het
Cnst A G 1: 179,610,194 H441R probably benign Het
Cyp2d11 G T 15: 82,390,437 T313N probably damaging Het
Cyp2g1 A G 7: 26,814,734 N255S possibly damaging Het
Dnah5 A G 15: 28,453,268 D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,327,352 probably null Het
Lama4 A G 10: 39,078,720 S1090G probably damaging Het
Malrd1 A G 2: 15,925,120 D1479G unknown Het
Man2a2 T C 7: 80,361,018 K742E probably benign Het
Mapk8 A T 14: 33,382,284 S392T probably benign Het
Mark3 T C 12: 111,592,683 I53T probably damaging Het
Mcmdc2 A G 1: 9,916,642 I219V probably benign Het
Mlycd A T 8: 119,407,593 E278V probably benign Het
Muc2 G T 7: 141,704,252 C29F Het
Mup20 T C 4: 62,053,484 I77V probably benign Het
Myh3 A G 11: 67,092,002 E849G probably damaging Het
Nedd4 A G 9: 72,686,107 N154S probably damaging Het
Olfr397 A T 11: 73,965,414 I269F probably benign Het
Pcdh7 A T 5: 57,720,336 N411I probably damaging Het
Plekhm1 A G 11: 103,395,060 I183T possibly damaging Het
Prkar2a G A 9: 108,692,511 V19M probably damaging Het
Prss35 T G 9: 86,755,613 N145K possibly damaging Het
Ranbp2 T A 10: 58,455,925 D251E possibly damaging Het
Rnf169 C A 7: 99,926,444 V315F probably damaging Het
Slc32a1 T C 2: 158,613,841 Y139H probably damaging Het
Slc5a2 T C 7: 128,271,156 V522A probably benign Het
Slc6a6 A T 6: 91,740,971 Q297L probably damaging Het
Sos2 A C 12: 69,598,824 Y914D probably damaging Het
Spata1 G T 3: 146,489,859 T32N possibly damaging Het
Srcap C T 7: 127,539,197 R1180C probably damaging Het
St14 A T 9: 31,131,625 M1K probably null Het
Tcp1 T C 17: 12,922,734 probably null Het
Tle6 A G 10: 81,591,054 V576A probably damaging Het
Ttc25 G A 11: 100,563,676 G429E probably benign Het
Usp17lc T A 7: 103,418,200 M234K probably benign Het
Zdhhc18 A G 4: 133,613,854 L236P probably damaging Het
Zfp266 T C 9: 20,500,314 D189G probably benign Het
Zfp474 A T 18: 52,639,157 D294V probably damaging Het
Zfp568 T C 7: 30,023,333 F568L probably damaging Het
Zfp93 A G 7: 24,276,054 K488R probably benign Het
Other mutations in Tcaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Tcaf1 APN 6 42686622 missense probably benign
IGL02415:Tcaf1 APN 6 42686650 missense probably benign 0.00
IGL02504:Tcaf1 APN 6 42679279 missense probably benign 0.05
IGL02960:Tcaf1 APN 6 42686459 missense probably benign
IGL03022:Tcaf1 APN 6 42678126 nonsense probably null
PIT4696001:Tcaf1 UTSW 6 42678539 missense probably benign 0.00
R0103:Tcaf1 UTSW 6 42686390 missense probably benign 0.23
R0103:Tcaf1 UTSW 6 42686390 missense probably benign 0.23
R0586:Tcaf1 UTSW 6 42673539 missense probably damaging 1.00
R0717:Tcaf1 UTSW 6 42678665 missense probably benign 0.01
R0724:Tcaf1 UTSW 6 42675367 missense probably damaging 1.00
R1166:Tcaf1 UTSW 6 42678678 missense probably benign
R1472:Tcaf1 UTSW 6 42686448 missense possibly damaging 0.83
R1538:Tcaf1 UTSW 6 42678989 missense probably damaging 1.00
R1721:Tcaf1 UTSW 6 42675338 missense possibly damaging 0.90
R1776:Tcaf1 UTSW 6 42678455 missense possibly damaging 0.90
R2136:Tcaf1 UTSW 6 42673520 missense probably benign 0.01
R3433:Tcaf1 UTSW 6 42686574 missense probably damaging 0.98
R3951:Tcaf1 UTSW 6 42679059 missense probably benign 0.14
R4472:Tcaf1 UTSW 6 42679314 missense probably benign
R4740:Tcaf1 UTSW 6 42686875 missense probably benign
R4915:Tcaf1 UTSW 6 42675196 missense probably damaging 1.00
R5249:Tcaf1 UTSW 6 42676859 missense probably benign 0.00
R5340:Tcaf1 UTSW 6 42678989 missense probably damaging 1.00
R5458:Tcaf1 UTSW 6 42686542 missense probably benign
R6196:Tcaf1 UTSW 6 42676807 missense probably damaging 1.00
R6772:Tcaf1 UTSW 6 42675276 missense probably damaging 1.00
R7066:Tcaf1 UTSW 6 42679177 missense probably damaging 1.00
R7145:Tcaf1 UTSW 6 42686753 missense probably damaging 1.00
R7204:Tcaf1 UTSW 6 42675039 splice site probably null
R7529:Tcaf1 UTSW 6 42675355 missense probably damaging 1.00
R7554:Tcaf1 UTSW 6 42677454 missense probably benign 0.13
R7813:Tcaf1 UTSW 6 42673429 nonsense probably null
R8191:Tcaf1 UTSW 6 42675256 missense probably damaging 1.00
RF013:Tcaf1 UTSW 6 42679173 missense probably benign 0.04
Z1177:Tcaf1 UTSW 6 42673477 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- GGAGGCCATAGCGCAATAT -3'
(R):5'- CGGTCCAGATGTGGTGATGAG -3'

Sequencing Primer
(F):5'- GCAATATTGGCACGGCTTC -3'
(R):5'- ATGATCTGCAAGTTCCCAAGTC -3'
Posted On2020-07-13