Mutagenetix > Incidental Mutation

Incidental Mutation 'R8194:Slc6a6'

635339

Institutional Source

Beutler Lab

Gene Symbol

Slc6a6

Ensembl Gene

ENSMUSG00000030096

Gene Name

solute carrier family 6 (neurotransmitter transporter, taurine), member 6

Synonyms

Taut

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8194 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

91684053-91759066 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 91740971 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 297 (Q297L)

Ref Sequence

ENSEMBL: ENSMUSP00000032185 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032185]

AlphaFold

O35316

Predicted Effect

probably damaging
Transcript: ENSMUST00000032185
AA Change: Q297L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000032185
Gene: ENSMUSG00000030096
AA Change: Q297L

Domain	Start	End	E-Value	Type
Pfam:SNF	41	568	1.2e-241	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000205663

Meta Mutation Damage Score

0.7954

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass membrane protein that is a member of a family of sodium and chloride-ion dependent transporters. The encoded protein transports taurine and beta-alanine. There is a pseudogene for this gene on chromosome 21. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutant mice have impaired vision associated with retinal degeneration. In addition to the visual defects, mutant mice exhibit reduced female fertility and decreased levels of taurine in a variety of tissues. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arid4a	T	A	12: 71,060,115	Y320*	probably null	Het
Ash1l	T	A	3: 89,052,755	C2265S	probably damaging	Het
Atg4b	T	A	1: 93,785,972	C55*	probably null	Het
Cacna1s	A	T	1: 136,077,692	N405I	probably benign	Het
Capn11	A	T	17: 45,633,399	D526E	probably damaging	Het
Ccdc188	A	G	16: 18,218,380	R71G	probably benign	Het
Ccser2	G	A	14: 36,896,263	R772W	probably damaging	Het
Cenpf	T	A	1: 189,682,403	E172D	probably benign	Het
Cep85	T	C	4: 134,134,089	M627V	probably null	Het
Chd1	G	A	17: 17,374,475		probably benign	Het
Cnst	A	G	1: 179,610,194	H441R	probably benign	Het
Cyp2d11	G	T	15: 82,390,437	T313N	probably damaging	Het
Cyp2g1	A	G	7: 26,814,734	N255S	possibly damaging	Het
Dnah5	A	G	15: 28,453,268	D4395G	probably damaging	Het
Fam83h	ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT	ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT	15: 76,002,775		probably benign	Het
Fcnb	C	T	2: 28,078,318	S209N	possibly damaging	Het
Gpsm1	CT	CTT	2: 26,327,352		probably null	Het
Lama4	A	G	10: 39,078,720	S1090G	probably damaging	Het
Malrd1	A	G	2: 15,925,120	D1479G	unknown	Het
Man2a2	T	C	7: 80,361,018	K742E	probably benign	Het
Mapk8	A	T	14: 33,382,284	S392T	probably benign	Het
Mark3	T	C	12: 111,592,683	I53T	probably damaging	Het
Mcmdc2	A	G	1: 9,916,642	I219V	probably benign	Het
Mlycd	A	T	8: 119,407,593	E278V	probably benign	Het
Muc2	G	T	7: 141,704,252	C29F		Het
Mup20	T	C	4: 62,053,484	I77V	probably benign	Het
Myh3	A	G	11: 67,092,002	E849G	probably damaging	Het
Nedd4	A	G	9: 72,686,107	N154S	probably damaging	Het
Olfr397	A	T	11: 73,965,414	I269F	probably benign	Het
Pcdh7	A	T	5: 57,720,336	N411I	probably damaging	Het
Plekhm1	A	G	11: 103,395,060	I183T	possibly damaging	Het
Prkar2a	G	A	9: 108,692,511	V19M	probably damaging	Het
Prss35	T	G	9: 86,755,613	N145K	possibly damaging	Het
Ranbp2	T	A	10: 58,455,925	D251E	possibly damaging	Het
Rnf169	C	A	7: 99,926,444	V315F	probably damaging	Het
Slc32a1	T	C	2: 158,613,841	Y139H	probably damaging	Het
Slc5a2	T	C	7: 128,271,156	V522A	probably benign	Het
Sos2	A	C	12: 69,598,824	Y914D	probably damaging	Het
Spata1	G	T	3: 146,489,859	T32N	possibly damaging	Het
Srcap	C	T	7: 127,539,197	R1180C	probably damaging	Het
St14	A	T	9: 31,131,625	M1K	probably null	Het
Tcaf1	T	C	6: 42,675,302	T749A	probably benign	Het
Tcp1	T	C	17: 12,922,734		probably null	Het
Tle6	A	G	10: 81,591,054	V576A	probably damaging	Het
Ttc25	G	A	11: 100,563,676	G429E	probably benign	Het
Usp17lc	T	A	7: 103,418,200	M234K	probably benign	Het
Washc4	A	G	10: 83,580,299	I818V	possibly damaging	Het
Zdhhc18	A	G	4: 133,613,854	L236P	probably damaging	Het
Zfp266	T	C	9: 20,500,314	D189G	probably benign	Het
Zfp474	A	T	18: 52,639,157	D294V	probably damaging	Het
Zfp568	T	C	7: 30,023,333	F568L	probably damaging	Het
Zfp93	A	G	7: 24,276,054	K488R	probably benign	Het

Other mutations in Slc6a6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00800:Slc6a6	APN	6	91741170	intron	probably benign
IGL01829:Slc6a6	APN	6	91735189	missense	probably damaging	1.00
IGL01896:Slc6a6	APN	6	91726069	missense	probably damaging	0.97
IGL02087:Slc6a6	APN	6	91735179	missense	probably benign
IGL02301:Slc6a6	APN	6	91726056	missense	probably benign	0.31
IGL02439:Slc6a6	APN	6	91749827	missense	probably damaging	0.99
IGL02555:Slc6a6	APN	6	91748330	unclassified	probably benign
animas	UTSW	6	91740014	splice site	probably null
customary	UTSW	6	91726243	nonsense	probably null
durango	UTSW	6	91723471	missense	probably damaging	1.00
habit	UTSW	6	91740971	missense	probably damaging	1.00
R5861_Slc6a6_905	UTSW	6	91741033	missense	probably damaging	1.00
R6665_Slc6a6_931	UTSW	6	91726039	missense	probably benign	0.38
R0530:Slc6a6	UTSW	6	91724958	missense	probably null	0.04
R1327:Slc6a6	UTSW	6	91726035	missense	probably benign	0.00
R1503:Slc6a6	UTSW	6	91740992	missense	probably damaging	1.00
R1612:Slc6a6	UTSW	6	91741027	missense	probably damaging	1.00
R2033:Slc6a6	UTSW	6	91724910	missense	probably benign	0.12
R2146:Slc6a6	UTSW	6	91735180	missense	probably benign	0.05
R2309:Slc6a6	UTSW	6	91726196	missense	possibly damaging	0.63
R2434:Slc6a6	UTSW	6	91735212	missense	probably benign	0.33
R2656:Slc6a6	UTSW	6	91741048	missense	probably damaging	1.00
R3402:Slc6a6	UTSW	6	91726129	missense	probably benign
R3403:Slc6a6	UTSW	6	91726129	missense	probably benign
R3978:Slc6a6	UTSW	6	91755052	missense	probably benign	0.41
R4236:Slc6a6	UTSW	6	91741276	missense	probably damaging	0.98
R4332:Slc6a6	UTSW	6	91723471	missense	probably damaging	1.00
R4980:Slc6a6	UTSW	6	91726060	missense	probably damaging	1.00
R5326:Slc6a6	UTSW	6	91735189	missense	probably damaging	1.00
R5358:Slc6a6	UTSW	6	91735174	missense	probably benign	0.28
R5542:Slc6a6	UTSW	6	91735189	missense	probably damaging	1.00
R5774:Slc6a6	UTSW	6	91745000	missense	probably damaging	1.00
R5839:Slc6a6	UTSW	6	91723317	missense	probably damaging	1.00
R5861:Slc6a6	UTSW	6	91741033	missense	probably damaging	1.00
R5939:Slc6a6	UTSW	6	91754948	missense	probably benign	0.01
R6160:Slc6a6	UTSW	6	91740014	splice site	probably null
R6262:Slc6a6	UTSW	6	91755032	missense	possibly damaging	0.66
R6265:Slc6a6	UTSW	6	91754915	missense	probably damaging	0.99
R6665:Slc6a6	UTSW	6	91726039	missense	probably benign	0.38
R6998:Slc6a6	UTSW	6	91752438	missense	probably benign	0.21
R7057:Slc6a6	UTSW	6	91741267	missense	probably damaging	1.00
R7568:Slc6a6	UTSW	6	91724851	missense	probably damaging	1.00
R7768:Slc6a6	UTSW	6	91739965	missense	probably damaging	0.99
R8042:Slc6a6	UTSW	6	91741245	missense	probably benign	0.11
R8125:Slc6a6	UTSW	6	91726106	missense	probably damaging	0.97
R8239:Slc6a6	UTSW	6	91724970	missense	probably benign	0.00
R8343:Slc6a6	UTSW	6	91726243	nonsense	probably null
R8363:Slc6a6	UTSW	6	91750296	missense	probably benign	0.03
R8836:Slc6a6	UTSW	6	91748463	missense	probably damaging	0.96
R9102:Slc6a6	UTSW	6	91754959	missense	probably benign	0.10
R9257:Slc6a6	UTSW	6	91739971	missense	possibly damaging	0.74
R9511:Slc6a6	UTSW	6	91744940	missense	probably damaging	1.00
R9526:Slc6a6	UTSW	6	91749827	missense	probably benign	0.02
R9701:Slc6a6	UTSW	6	91723497	missense	probably damaging	1.00
X0002:Slc6a6	UTSW	6	91723476	missense	probably damaging	1.00
X0063:Slc6a6	UTSW	6	91741224	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCTCTGGGGTTCTAGATCTGC -3'
(R):5'- GTACCACTGTTCAGGCATCC -3'

Sequencing Primer
(F):5'- GGTTCTAGATCTGCCCTCTGG -3'
(R):5'- CTAAGTTACACACACGTCAGGGG -3'

Posted On

2020-07-13