Incidental Mutation 'R8194:Slc6a6'
ID635339
Institutional Source Beutler Lab
Gene Symbol Slc6a6
Ensembl Gene ENSMUSG00000030096
Gene Namesolute carrier family 6 (neurotransmitter transporter, taurine), member 6
SynonymsTaut
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8194 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location91684053-91759066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91740971 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 297 (Q297L)
Ref Sequence ENSEMBL: ENSMUSP00000032185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032185]
Predicted Effect probably damaging
Transcript: ENSMUST00000032185
AA Change: Q297L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032185
Gene: ENSMUSG00000030096
AA Change: Q297L

DomainStartEndE-ValueType
Pfam:SNF 41 568 1.2e-241 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205663
Meta Mutation Damage Score 0.7954 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass membrane protein that is a member of a family of sodium and chloride-ion dependent transporters. The encoded protein transports taurine and beta-alanine. There is a pseudogene for this gene on chromosome 21. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutant mice have impaired vision associated with retinal degeneration. In addition to the visual defects, mutant mice exhibit reduced female fertility and decreased levels of taurine in a variety of tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230046K03Rik A G 10: 83,580,299 I818V possibly damaging Het
Arid4a T A 12: 71,060,115 Y320* probably null Het
Ash1l T A 3: 89,052,755 C2265S probably damaging Het
Atg4b T A 1: 93,785,972 C55* probably null Het
Cacna1s A T 1: 136,077,692 N405I probably benign Het
Capn11 A T 17: 45,633,399 D526E probably damaging Het
Ccdc188 A G 16: 18,218,380 R71G probably benign Het
Ccser2 G A 14: 36,896,263 R772W probably damaging Het
Cenpf T A 1: 189,682,403 E172D probably benign Het
Cep85 T C 4: 134,134,089 M627V probably null Het
Chd1 G A 17: 17,374,475 probably benign Het
Cnst A G 1: 179,610,194 H441R probably benign Het
Cyp2d11 G T 15: 82,390,437 T313N probably damaging Het
Cyp2g1 A G 7: 26,814,734 N255S possibly damaging Het
Dnah5 A G 15: 28,453,268 D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,327,352 probably null Het
Lama4 A G 10: 39,078,720 S1090G probably damaging Het
Malrd1 A G 2: 15,925,120 D1479G unknown Het
Man2a2 T C 7: 80,361,018 K742E probably benign Het
Mapk8 A T 14: 33,382,284 S392T probably benign Het
Mark3 T C 12: 111,592,683 I53T probably damaging Het
Mcmdc2 A G 1: 9,916,642 I219V probably benign Het
Mlycd A T 8: 119,407,593 E278V probably benign Het
Muc2 G T 7: 141,704,252 C29F Het
Mup20 T C 4: 62,053,484 I77V probably benign Het
Myh3 A G 11: 67,092,002 E849G probably damaging Het
Nedd4 A G 9: 72,686,107 N154S probably damaging Het
Olfr397 A T 11: 73,965,414 I269F probably benign Het
Pcdh7 A T 5: 57,720,336 N411I probably damaging Het
Plekhm1 A G 11: 103,395,060 I183T possibly damaging Het
Prkar2a G A 9: 108,692,511 V19M probably damaging Het
Prss35 T G 9: 86,755,613 N145K possibly damaging Het
Ranbp2 T A 10: 58,455,925 D251E possibly damaging Het
Rnf169 C A 7: 99,926,444 V315F probably damaging Het
Slc32a1 T C 2: 158,613,841 Y139H probably damaging Het
Slc5a2 T C 7: 128,271,156 V522A probably benign Het
Sos2 A C 12: 69,598,824 Y914D probably damaging Het
Spata1 G T 3: 146,489,859 T32N possibly damaging Het
Srcap C T 7: 127,539,197 R1180C probably damaging Het
St14 A T 9: 31,131,625 M1K probably null Het
Tcaf1 T C 6: 42,675,302 T749A probably benign Het
Tcp1 T C 17: 12,922,734 probably null Het
Tle6 A G 10: 81,591,054 V576A probably damaging Het
Ttc25 G A 11: 100,563,676 G429E probably benign Het
Usp17lc T A 7: 103,418,200 M234K probably benign Het
Zdhhc18 A G 4: 133,613,854 L236P probably damaging Het
Zfp266 T C 9: 20,500,314 D189G probably benign Het
Zfp474 A T 18: 52,639,157 D294V probably damaging Het
Zfp568 T C 7: 30,023,333 F568L probably damaging Het
Zfp93 A G 7: 24,276,054 K488R probably benign Het
Other mutations in Slc6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00800:Slc6a6 APN 6 91741170 intron probably benign
IGL01829:Slc6a6 APN 6 91735189 missense probably damaging 1.00
IGL01896:Slc6a6 APN 6 91726069 missense probably damaging 0.97
IGL02087:Slc6a6 APN 6 91735179 missense probably benign
IGL02301:Slc6a6 APN 6 91726056 missense probably benign 0.31
IGL02439:Slc6a6 APN 6 91749827 missense probably damaging 0.99
IGL02555:Slc6a6 APN 6 91748330 unclassified probably benign
animas UTSW 6 91740014 splice site probably null
durango UTSW 6 91723471 missense probably damaging 1.00
habit UTSW 6 91740971 missense probably damaging 1.00
R0530:Slc6a6 UTSW 6 91724958 missense probably null 0.04
R1327:Slc6a6 UTSW 6 91726035 missense probably benign 0.00
R1503:Slc6a6 UTSW 6 91740992 missense probably damaging 1.00
R1612:Slc6a6 UTSW 6 91741027 missense probably damaging 1.00
R2033:Slc6a6 UTSW 6 91724910 missense probably benign 0.12
R2146:Slc6a6 UTSW 6 91735180 missense probably benign 0.05
R2309:Slc6a6 UTSW 6 91726196 missense possibly damaging 0.63
R2434:Slc6a6 UTSW 6 91735212 missense probably benign 0.33
R2656:Slc6a6 UTSW 6 91741048 missense probably damaging 1.00
R3402:Slc6a6 UTSW 6 91726129 missense probably benign
R3403:Slc6a6 UTSW 6 91726129 missense probably benign
R3978:Slc6a6 UTSW 6 91755052 missense probably benign 0.41
R4236:Slc6a6 UTSW 6 91741276 missense probably damaging 0.98
R4332:Slc6a6 UTSW 6 91723471 missense probably damaging 1.00
R4980:Slc6a6 UTSW 6 91726060 missense probably damaging 1.00
R5326:Slc6a6 UTSW 6 91735189 missense probably damaging 1.00
R5358:Slc6a6 UTSW 6 91735174 missense probably benign 0.28
R5542:Slc6a6 UTSW 6 91735189 missense probably damaging 1.00
R5774:Slc6a6 UTSW 6 91745000 missense probably damaging 1.00
R5839:Slc6a6 UTSW 6 91723317 missense probably damaging 1.00
R5861:Slc6a6 UTSW 6 91741033 missense probably damaging 1.00
R5939:Slc6a6 UTSW 6 91754948 missense probably benign 0.01
R6160:Slc6a6 UTSW 6 91740014 splice site probably null
R6262:Slc6a6 UTSW 6 91755032 missense possibly damaging 0.66
R6265:Slc6a6 UTSW 6 91754915 missense probably damaging 0.99
R6665:Slc6a6 UTSW 6 91726039 missense probably benign 0.38
R6998:Slc6a6 UTSW 6 91752438 missense probably benign 0.21
R7057:Slc6a6 UTSW 6 91741267 missense probably damaging 1.00
R7568:Slc6a6 UTSW 6 91724851 missense probably damaging 1.00
R7768:Slc6a6 UTSW 6 91739965 missense probably damaging 0.99
R8042:Slc6a6 UTSW 6 91741245 missense probably benign 0.11
R8125:Slc6a6 UTSW 6 91726106 missense probably damaging 0.97
R8239:Slc6a6 UTSW 6 91724970 missense probably benign 0.00
R8343:Slc6a6 UTSW 6 91726243 nonsense probably null
R8363:Slc6a6 UTSW 6 91750296 missense probably benign 0.03
X0002:Slc6a6 UTSW 6 91723476 missense probably damaging 1.00
X0063:Slc6a6 UTSW 6 91741224 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCTGGGGTTCTAGATCTGC -3'
(R):5'- GTACCACTGTTCAGGCATCC -3'

Sequencing Primer
(F):5'- GGTTCTAGATCTGCCCTCTGG -3'
(R):5'- CTAAGTTACACACACGTCAGGGG -3'
Posted On2020-07-13