Incidental Mutation 'R8194:Zfp93'
ID 635340
Institutional Source Beutler Lab
Gene Symbol Zfp93
Ensembl Gene ENSMUSG00000055305
Gene Name zinc finger protein 93
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R8194 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 24270420-24277794 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24276054 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 488 (K488R)
Ref Sequence ENSEMBL: ENSMUSP00000032696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032696] [ENSMUST00000108438]
AlphaFold Q61116
Predicted Effect probably benign
Transcript: ENSMUST00000032696
AA Change: K488R

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000032696
Gene: ENSMUSG00000055305
AA Change: K488R

DomainStartEndE-ValueType
KRAB 8 74 8.06e-19 SMART
ZnF_C2H2 285 307 2.71e-2 SMART
ZnF_C2H2 313 335 1.69e-3 SMART
ZnF_C2H2 341 363 8.02e-5 SMART
ZnF_C2H2 369 391 2.36e-2 SMART
ZnF_C2H2 397 419 1.2e-3 SMART
ZnF_C2H2 425 447 2.84e-5 SMART
ZnF_C2H2 453 475 7.78e-3 SMART
ZnF_C2H2 481 503 1.12e-3 SMART
ZnF_C2H2 509 531 2.57e-3 SMART
ZnF_C2H2 537 559 9.73e-4 SMART
ZnF_C2H2 565 587 4.94e-5 SMART
ZnF_C2H2 593 615 9.73e-4 SMART
ZnF_C2H2 621 643 5.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108438
AA Change: K488R

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000104077
Gene: ENSMUSG00000055305
AA Change: K488R

DomainStartEndE-ValueType
KRAB 8 74 8.06e-19 SMART
ZnF_C2H2 285 307 2.71e-2 SMART
ZnF_C2H2 313 335 1.69e-3 SMART
ZnF_C2H2 341 363 8.02e-5 SMART
ZnF_C2H2 369 391 2.36e-2 SMART
ZnF_C2H2 397 419 1.2e-3 SMART
ZnF_C2H2 425 447 2.84e-5 SMART
ZnF_C2H2 453 475 7.78e-3 SMART
ZnF_C2H2 481 503 1.12e-3 SMART
ZnF_C2H2 509 531 2.57e-3 SMART
ZnF_C2H2 537 559 9.73e-4 SMART
ZnF_C2H2 565 587 4.94e-5 SMART
ZnF_C2H2 593 615 9.73e-4 SMART
ZnF_C2H2 621 643 5.5e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230046K03Rik A G 10: 83,580,299 I818V possibly damaging Het
Arid4a T A 12: 71,060,115 Y320* probably null Het
Ash1l T A 3: 89,052,755 C2265S probably damaging Het
Atg4b T A 1: 93,785,972 C55* probably null Het
Cacna1s A T 1: 136,077,692 N405I probably benign Het
Capn11 A T 17: 45,633,399 D526E probably damaging Het
Ccdc188 A G 16: 18,218,380 R71G probably benign Het
Ccser2 G A 14: 36,896,263 R772W probably damaging Het
Cenpf T A 1: 189,682,403 E172D probably benign Het
Cep85 T C 4: 134,134,089 M627V probably null Het
Chd1 G A 17: 17,374,475 probably benign Het
Cnst A G 1: 179,610,194 H441R probably benign Het
Cyp2d11 G T 15: 82,390,437 T313N probably damaging Het
Cyp2g1 A G 7: 26,814,734 N255S possibly damaging Het
Dnah5 A G 15: 28,453,268 D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,327,352 probably null Het
Lama4 A G 10: 39,078,720 S1090G probably damaging Het
Malrd1 A G 2: 15,925,120 D1479G unknown Het
Man2a2 T C 7: 80,361,018 K742E probably benign Het
Mapk8 A T 14: 33,382,284 S392T probably benign Het
Mark3 T C 12: 111,592,683 I53T probably damaging Het
Mcmdc2 A G 1: 9,916,642 I219V probably benign Het
Mlycd A T 8: 119,407,593 E278V probably benign Het
Muc2 G T 7: 141,704,252 C29F Het
Mup20 T C 4: 62,053,484 I77V probably benign Het
Myh3 A G 11: 67,092,002 E849G probably damaging Het
Nedd4 A G 9: 72,686,107 N154S probably damaging Het
Olfr397 A T 11: 73,965,414 I269F probably benign Het
Pcdh7 A T 5: 57,720,336 N411I probably damaging Het
Plekhm1 A G 11: 103,395,060 I183T possibly damaging Het
Prkar2a G A 9: 108,692,511 V19M probably damaging Het
Prss35 T G 9: 86,755,613 N145K possibly damaging Het
Ranbp2 T A 10: 58,455,925 D251E possibly damaging Het
Rnf169 C A 7: 99,926,444 V315F probably damaging Het
Slc32a1 T C 2: 158,613,841 Y139H probably damaging Het
Slc5a2 T C 7: 128,271,156 V522A probably benign Het
Slc6a6 A T 6: 91,740,971 Q297L probably damaging Het
Sos2 A C 12: 69,598,824 Y914D probably damaging Het
Spata1 G T 3: 146,489,859 T32N possibly damaging Het
Srcap C T 7: 127,539,197 R1180C probably damaging Het
St14 A T 9: 31,131,625 M1K probably null Het
Tcaf1 T C 6: 42,675,302 T749A probably benign Het
Tcp1 T C 17: 12,922,734 probably null Het
Tle6 A G 10: 81,591,054 V576A probably damaging Het
Ttc25 G A 11: 100,563,676 G429E probably benign Het
Usp17lc T A 7: 103,418,200 M234K probably benign Het
Zdhhc18 A G 4: 133,613,854 L236P probably damaging Het
Zfp266 T C 9: 20,500,314 D189G probably benign Het
Zfp474 A T 18: 52,639,157 D294V probably damaging Het
Zfp568 T C 7: 30,023,333 F568L probably damaging Het
Other mutations in Zfp93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Zfp93 APN 7 24275692 missense probably damaging 1.00
IGL02939:Zfp93 APN 7 24275084 missense possibly damaging 0.86
IGL02956:Zfp93 APN 7 24274975 missense probably benign 0.25
FR4342:Zfp93 UTSW 7 24275586 missense possibly damaging 0.92
FR4737:Zfp93 UTSW 7 24275389 small deletion probably benign
R0099:Zfp93 UTSW 7 24275475 missense probably benign 0.01
R0376:Zfp93 UTSW 7 24275861 missense probably damaging 1.00
R1466:Zfp93 UTSW 7 24276096 missense probably damaging 0.99
R1466:Zfp93 UTSW 7 24276096 missense probably damaging 0.99
R1511:Zfp93 UTSW 7 24275731 nonsense probably null
R1628:Zfp93 UTSW 7 24274857 missense probably benign 0.00
R4581:Zfp93 UTSW 7 24275668 missense probably damaging 1.00
R4977:Zfp93 UTSW 7 24275411 missense probably benign 0.00
R5162:Zfp93 UTSW 7 24276332 missense probably damaging 1.00
R6031:Zfp93 UTSW 7 24276300 missense probably damaging 1.00
R6031:Zfp93 UTSW 7 24276300 missense probably damaging 1.00
R6284:Zfp93 UTSW 7 24275629 nonsense probably null
R6471:Zfp93 UTSW 7 24273329 missense probably damaging 1.00
R6694:Zfp93 UTSW 7 24275913 missense probably damaging 1.00
R6969:Zfp93 UTSW 7 24275381 nonsense probably null
R7543:Zfp93 UTSW 7 24275108 missense probably benign 0.13
R7623:Zfp93 UTSW 7 24276369 missense probably damaging 1.00
R7763:Zfp93 UTSW 7 24275218 missense possibly damaging 0.56
R7957:Zfp93 UTSW 7 24275574 missense probably damaging 1.00
R8157:Zfp93 UTSW 7 24276460 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAGGTTTCCGTCAGAGCTCAG -3'
(R):5'- TTGCTGAACTGCTTCTGGC -3'

Sequencing Primer
(F):5'- GCTTCAGCTTAAGTGGCAAC -3'
(R):5'- CAAACATTGCATTTGAATGGTTTTTC -3'
Posted On 2020-07-13