Incidental Mutation 'R8194:Zfp93'
ID635340
Institutional Source Beutler Lab
Gene Symbol Zfp93
Ensembl Gene ENSMUSG00000055305
Gene Namezinc finger protein 93
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R8194 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location24270420-24277794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24276054 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 488 (K488R)
Ref Sequence ENSEMBL: ENSMUSP00000032696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032696] [ENSMUST00000108438]
Predicted Effect probably benign
Transcript: ENSMUST00000032696
AA Change: K488R

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000032696
Gene: ENSMUSG00000055305
AA Change: K488R

DomainStartEndE-ValueType
KRAB 8 74 8.06e-19 SMART
ZnF_C2H2 285 307 2.71e-2 SMART
ZnF_C2H2 313 335 1.69e-3 SMART
ZnF_C2H2 341 363 8.02e-5 SMART
ZnF_C2H2 369 391 2.36e-2 SMART
ZnF_C2H2 397 419 1.2e-3 SMART
ZnF_C2H2 425 447 2.84e-5 SMART
ZnF_C2H2 453 475 7.78e-3 SMART
ZnF_C2H2 481 503 1.12e-3 SMART
ZnF_C2H2 509 531 2.57e-3 SMART
ZnF_C2H2 537 559 9.73e-4 SMART
ZnF_C2H2 565 587 4.94e-5 SMART
ZnF_C2H2 593 615 9.73e-4 SMART
ZnF_C2H2 621 643 5.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108438
AA Change: K488R

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000104077
Gene: ENSMUSG00000055305
AA Change: K488R

DomainStartEndE-ValueType
KRAB 8 74 8.06e-19 SMART
ZnF_C2H2 285 307 2.71e-2 SMART
ZnF_C2H2 313 335 1.69e-3 SMART
ZnF_C2H2 341 363 8.02e-5 SMART
ZnF_C2H2 369 391 2.36e-2 SMART
ZnF_C2H2 397 419 1.2e-3 SMART
ZnF_C2H2 425 447 2.84e-5 SMART
ZnF_C2H2 453 475 7.78e-3 SMART
ZnF_C2H2 481 503 1.12e-3 SMART
ZnF_C2H2 509 531 2.57e-3 SMART
ZnF_C2H2 537 559 9.73e-4 SMART
ZnF_C2H2 565 587 4.94e-5 SMART
ZnF_C2H2 593 615 9.73e-4 SMART
ZnF_C2H2 621 643 5.5e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230046K03Rik A G 10: 83,580,299 I818V possibly damaging Het
Arid4a T A 12: 71,060,115 Y320* probably null Het
Ash1l T A 3: 89,052,755 C2265S probably damaging Het
Atg4b T A 1: 93,785,972 C55* probably null Het
Cacna1s A T 1: 136,077,692 N405I probably benign Het
Capn11 A T 17: 45,633,399 D526E probably damaging Het
Ccdc188 A G 16: 18,218,380 R71G probably benign Het
Ccser2 G A 14: 36,896,263 R772W probably damaging Het
Cenpf T A 1: 189,682,403 E172D probably benign Het
Cep85 T C 4: 134,134,089 M627V probably null Het
Chd1 G A 17: 17,374,475 probably benign Het
Cnst A G 1: 179,610,194 H441R probably benign Het
Cyp2d11 G T 15: 82,390,437 T313N probably damaging Het
Cyp2g1 A G 7: 26,814,734 N255S possibly damaging Het
Dnah5 A G 15: 28,453,268 D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,327,352 probably null Het
Lama4 A G 10: 39,078,720 S1090G probably damaging Het
Malrd1 A G 2: 15,925,120 D1479G unknown Het
Man2a2 T C 7: 80,361,018 K742E probably benign Het
Mapk8 A T 14: 33,382,284 S392T probably benign Het
Mark3 T C 12: 111,592,683 I53T probably damaging Het
Mcmdc2 A G 1: 9,916,642 I219V probably benign Het
Mlycd A T 8: 119,407,593 E278V probably benign Het
Muc2 G T 7: 141,704,252 C29F Het
Mup20 T C 4: 62,053,484 I77V probably benign Het
Myh3 A G 11: 67,092,002 E849G probably damaging Het
Nedd4 A G 9: 72,686,107 N154S probably damaging Het
Olfr397 A T 11: 73,965,414 I269F probably benign Het
Pcdh7 A T 5: 57,720,336 N411I probably damaging Het
Plekhm1 A G 11: 103,395,060 I183T possibly damaging Het
Prkar2a G A 9: 108,692,511 V19M probably damaging Het
Prss35 T G 9: 86,755,613 N145K possibly damaging Het
Ranbp2 T A 10: 58,455,925 D251E possibly damaging Het
Rnf169 C A 7: 99,926,444 V315F probably damaging Het
Slc32a1 T C 2: 158,613,841 Y139H probably damaging Het
Slc5a2 T C 7: 128,271,156 V522A probably benign Het
Slc6a6 A T 6: 91,740,971 Q297L probably damaging Het
Sos2 A C 12: 69,598,824 Y914D probably damaging Het
Spata1 G T 3: 146,489,859 T32N possibly damaging Het
Srcap C T 7: 127,539,197 R1180C probably damaging Het
St14 A T 9: 31,131,625 M1K probably null Het
Tcaf1 T C 6: 42,675,302 T749A probably benign Het
Tcp1 T C 17: 12,922,734 probably null Het
Tle6 A G 10: 81,591,054 V576A probably damaging Het
Ttc25 G A 11: 100,563,676 G429E probably benign Het
Usp17lc T A 7: 103,418,200 M234K probably benign Het
Zdhhc18 A G 4: 133,613,854 L236P probably damaging Het
Zfp266 T C 9: 20,500,314 D189G probably benign Het
Zfp474 A T 18: 52,639,157 D294V probably damaging Het
Zfp568 T C 7: 30,023,333 F568L probably damaging Het
Other mutations in Zfp93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Zfp93 APN 7 24275692 missense probably damaging 1.00
IGL02939:Zfp93 APN 7 24275084 missense possibly damaging 0.86
IGL02956:Zfp93 APN 7 24274975 missense probably benign 0.25
FR4342:Zfp93 UTSW 7 24275586 missense possibly damaging 0.92
FR4737:Zfp93 UTSW 7 24275389 small deletion probably benign
R0099:Zfp93 UTSW 7 24275475 missense probably benign 0.01
R0376:Zfp93 UTSW 7 24275861 missense probably damaging 1.00
R1466:Zfp93 UTSW 7 24276096 missense probably damaging 0.99
R1466:Zfp93 UTSW 7 24276096 missense probably damaging 0.99
R1511:Zfp93 UTSW 7 24275731 nonsense probably null
R1628:Zfp93 UTSW 7 24274857 missense probably benign 0.00
R4581:Zfp93 UTSW 7 24275668 missense probably damaging 1.00
R4977:Zfp93 UTSW 7 24275411 missense probably benign 0.00
R5162:Zfp93 UTSW 7 24276332 missense probably damaging 1.00
R6031:Zfp93 UTSW 7 24276300 missense probably damaging 1.00
R6031:Zfp93 UTSW 7 24276300 missense probably damaging 1.00
R6284:Zfp93 UTSW 7 24275629 nonsense probably null
R6471:Zfp93 UTSW 7 24273329 missense probably damaging 1.00
R6694:Zfp93 UTSW 7 24275913 missense probably damaging 1.00
R6969:Zfp93 UTSW 7 24275381 nonsense probably null
R7543:Zfp93 UTSW 7 24275108 missense probably benign 0.13
R7623:Zfp93 UTSW 7 24276369 missense probably damaging 1.00
R7763:Zfp93 UTSW 7 24275218 missense possibly damaging 0.56
R7957:Zfp93 UTSW 7 24275574 missense probably damaging 1.00
R8157:Zfp93 UTSW 7 24276460 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAGGTTTCCGTCAGAGCTCAG -3'
(R):5'- TTGCTGAACTGCTTCTGGC -3'

Sequencing Primer
(F):5'- GCTTCAGCTTAAGTGGCAAC -3'
(R):5'- CAAACATTGCATTTGAATGGTTTTTC -3'
Posted On2020-07-13