Incidental Mutation 'R8194:Zfp568'
ID635342
Institutional Source Beutler Lab
Gene Symbol Zfp568
Ensembl Gene ENSMUSG00000074221
Gene Namezinc finger protein 568
Synonymschato, LOC381866
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8194 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location29983955-30028282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30023333 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 568 (F568L)
Ref Sequence ENSEMBL: ENSMUSP00000118387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074322] [ENSMUST00000146074] [ENSMUST00000148442] [ENSMUST00000177931]
Predicted Effect probably damaging
Transcript: ENSMUST00000074322
AA Change: F568L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073930
Gene: ENSMUSG00000074221
AA Change: F568L

DomainStartEndE-ValueType
KRAB 34 94 2.73e-39 SMART
KRAB 124 184 2.01e-28 SMART
ZnF_C2H2 363 385 7.78e-3 SMART
ZnF_C2H2 391 413 3.95e-4 SMART
ZnF_C2H2 419 441 3.44e-4 SMART
ZnF_C2H2 447 469 2.2e-2 SMART
ZnF_C2H2 475 497 6.67e-2 SMART
ZnF_C2H2 503 525 6.32e-3 SMART
ZnF_C2H2 531 553 4.87e-4 SMART
ZnF_C2H2 559 581 2.09e-3 SMART
ZnF_C2H2 587 609 2.95e-3 SMART
ZnF_C2H2 615 637 3.69e-4 SMART
ZnF_C2H2 643 665 1.12e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000146074
AA Change: F567L

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118823
Gene: ENSMUSG00000074221
AA Change: F567L

DomainStartEndE-ValueType
KRAB 34 94 2.73e-39 SMART
KRAB 123 183 2.01e-28 SMART
ZnF_C2H2 362 384 7.78e-3 SMART
ZnF_C2H2 390 412 3.95e-4 SMART
ZnF_C2H2 418 440 3.44e-4 SMART
ZnF_C2H2 446 468 2.2e-2 SMART
ZnF_C2H2 474 496 6.67e-2 SMART
ZnF_C2H2 502 524 6.32e-3 SMART
ZnF_C2H2 530 552 4.87e-4 SMART
ZnF_C2H2 558 580 2.09e-3 SMART
ZnF_C2H2 586 608 2.95e-3 SMART
ZnF_C2H2 614 636 3.69e-4 SMART
ZnF_C2H2 642 664 1.12e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148442
AA Change: F568L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118387
Gene: ENSMUSG00000074221
AA Change: F568L

DomainStartEndE-ValueType
KRAB 34 94 2.73e-39 SMART
KRAB 124 184 2.01e-28 SMART
ZnF_C2H2 363 385 7.78e-3 SMART
ZnF_C2H2 391 413 3.95e-4 SMART
ZnF_C2H2 419 441 3.44e-4 SMART
ZnF_C2H2 447 469 2.2e-2 SMART
ZnF_C2H2 475 497 6.67e-2 SMART
ZnF_C2H2 503 525 6.32e-3 SMART
ZnF_C2H2 531 553 4.87e-4 SMART
ZnF_C2H2 559 581 2.09e-3 SMART
ZnF_C2H2 587 609 2.95e-3 SMART
ZnF_C2H2 615 637 3.69e-4 SMART
ZnF_C2H2 643 665 1.12e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177931
AA Change: F567L

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000137438
Gene: ENSMUSG00000074221
AA Change: F567L

DomainStartEndE-ValueType
KRAB 34 94 2.73e-39 SMART
KRAB 123 183 2.01e-28 SMART
ZnF_C2H2 362 384 7.78e-3 SMART
ZnF_C2H2 390 412 3.95e-4 SMART
ZnF_C2H2 418 440 3.44e-4 SMART
ZnF_C2H2 446 468 2.2e-2 SMART
ZnF_C2H2 474 496 6.67e-2 SMART
ZnF_C2H2 502 524 6.32e-3 SMART
ZnF_C2H2 530 552 4.87e-4 SMART
ZnF_C2H2 558 580 2.09e-3 SMART
ZnF_C2H2 586 608 2.95e-3 SMART
ZnF_C2H2 614 636 3.69e-4 SMART
ZnF_C2H2 642 664 1.12e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Homozygous null mutants are embryonic lethal with growth arrest around E8.5-9.0. Mutant embryo shows shortened anterior-posterior axial extension with defects in somites and midline structures including open gut tube, cardia bifida, and failure to closeneural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230046K03Rik A G 10: 83,580,299 I818V possibly damaging Het
Arid4a T A 12: 71,060,115 Y320* probably null Het
Ash1l T A 3: 89,052,755 C2265S probably damaging Het
Atg4b T A 1: 93,785,972 C55* probably null Het
Cacna1s A T 1: 136,077,692 N405I probably benign Het
Capn11 A T 17: 45,633,399 D526E probably damaging Het
Ccdc188 A G 16: 18,218,380 R71G probably benign Het
Ccser2 G A 14: 36,896,263 R772W probably damaging Het
Cenpf T A 1: 189,682,403 E172D probably benign Het
Cep85 T C 4: 134,134,089 M627V probably null Het
Chd1 G A 17: 17,374,475 probably benign Het
Cnst A G 1: 179,610,194 H441R probably benign Het
Cyp2d11 G T 15: 82,390,437 T313N probably damaging Het
Cyp2g1 A G 7: 26,814,734 N255S possibly damaging Het
Dnah5 A G 15: 28,453,268 D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,327,352 probably null Het
Lama4 A G 10: 39,078,720 S1090G probably damaging Het
Malrd1 A G 2: 15,925,120 D1479G unknown Het
Man2a2 T C 7: 80,361,018 K742E probably benign Het
Mapk8 A T 14: 33,382,284 S392T probably benign Het
Mark3 T C 12: 111,592,683 I53T probably damaging Het
Mcmdc2 A G 1: 9,916,642 I219V probably benign Het
Mlycd A T 8: 119,407,593 E278V probably benign Het
Muc2 G T 7: 141,704,252 C29F Het
Mup20 T C 4: 62,053,484 I77V probably benign Het
Myh3 A G 11: 67,092,002 E849G probably damaging Het
Nedd4 A G 9: 72,686,107 N154S probably damaging Het
Olfr397 A T 11: 73,965,414 I269F probably benign Het
Pcdh7 A T 5: 57,720,336 N411I probably damaging Het
Plekhm1 A G 11: 103,395,060 I183T possibly damaging Het
Prkar2a G A 9: 108,692,511 V19M probably damaging Het
Prss35 T G 9: 86,755,613 N145K possibly damaging Het
Ranbp2 T A 10: 58,455,925 D251E possibly damaging Het
Rnf169 C A 7: 99,926,444 V315F probably damaging Het
Slc32a1 T C 2: 158,613,841 Y139H probably damaging Het
Slc5a2 T C 7: 128,271,156 V522A probably benign Het
Slc6a6 A T 6: 91,740,971 Q297L probably damaging Het
Sos2 A C 12: 69,598,824 Y914D probably damaging Het
Spata1 G T 3: 146,489,859 T32N possibly damaging Het
Srcap C T 7: 127,539,197 R1180C probably damaging Het
St14 A T 9: 31,131,625 M1K probably null Het
Tcaf1 T C 6: 42,675,302 T749A probably benign Het
Tcp1 T C 17: 12,922,734 probably null Het
Tle6 A G 10: 81,591,054 V576A probably damaging Het
Ttc25 G A 11: 100,563,676 G429E probably benign Het
Usp17lc T A 7: 103,418,200 M234K probably benign Het
Zdhhc18 A G 4: 133,613,854 L236P probably damaging Het
Zfp266 T C 9: 20,500,314 D189G probably benign Het
Zfp474 A T 18: 52,639,157 D294V probably damaging Het
Zfp93 A G 7: 24,276,054 K488R probably benign Het
Other mutations in Zfp568
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Zfp568 APN 7 30022440 missense possibly damaging 0.66
IGL00792:Zfp568 APN 7 30015072 missense probably benign 0.00
IGL01133:Zfp568 APN 7 29987808 critical splice donor site probably null
IGL01330:Zfp568 APN 7 30022277 missense probably benign 0.01
IGL03157:Zfp568 APN 7 30022764 missense probably damaging 1.00
R0739:Zfp568 UTSW 7 30023321 missense probably damaging 1.00
R1051:Zfp568 UTSW 7 30022529 nonsense probably null
R1967:Zfp568 UTSW 7 29989088 missense probably damaging 0.99
R2038:Zfp568 UTSW 7 29989082 missense probably null 1.00
R3874:Zfp568 UTSW 7 30023396 missense probably damaging 1.00
R4438:Zfp568 UTSW 7 30022296 missense probably benign
R4584:Zfp568 UTSW 7 29998192 missense probably benign 0.04
R4667:Zfp568 UTSW 7 30023277 missense probably damaging 1.00
R4669:Zfp568 UTSW 7 30023277 missense probably damaging 1.00
R4773:Zfp568 UTSW 7 29997770 missense probably damaging 1.00
R4791:Zfp568 UTSW 7 30015183 missense probably damaging 1.00
R5250:Zfp568 UTSW 7 30017230 missense probably benign 0.12
R5541:Zfp568 UTSW 7 30022876 missense possibly damaging 0.81
R5956:Zfp568 UTSW 7 29997863 missense probably damaging 1.00
R6444:Zfp568 UTSW 7 30017257 missense probably benign 0.01
R6600:Zfp568 UTSW 7 30022523 missense possibly damaging 0.71
R7299:Zfp568 UTSW 7 30017244 missense probably benign 0.34
R7316:Zfp568 UTSW 7 30022256 missense possibly damaging 0.95
R7562:Zfp568 UTSW 7 30023256 missense probably benign 0.04
R7664:Zfp568 UTSW 7 30022290 missense probably benign
R7672:Zfp568 UTSW 7 29997787 missense probably damaging 0.99
R7759:Zfp568 UTSW 7 30023414 missense possibly damaging 0.66
R7790:Zfp568 UTSW 7 30022725 missense probably damaging 1.00
R7811:Zfp568 UTSW 7 29997870 missense possibly damaging 0.95
R8110:Zfp568 UTSW 7 30023126 missense probably damaging 1.00
R8254:Zfp568 UTSW 7 30015133 missense probably benign 0.22
R8319:Zfp568 UTSW 7 29998204 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TGTATAGCTGTGCCTCCCAG -3'
(R):5'- TTCTGGTGTCGACTGAGCTC -3'

Sequencing Primer
(F):5'- ACCAGATGTCACACACTGGGG -3'
(R):5'- TGTCGACTGAGCTCTGAGC -3'
Posted On2020-07-13