Incidental Mutation 'R8194:Man2a2'
ID635343
Institutional Source Beutler Lab
Gene Symbol Man2a2
Ensembl Gene ENSMUSG00000038886
Gene Namemannosidase 2, alpha 2
Synonymsalpha mannosidase IIx, 1700052O22Rik, MX, 4931438M07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R8194 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location80349097-80371375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80361018 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 742 (K742E)
Ref Sequence ENSEMBL: ENSMUSP00000095949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098346] [ENSMUST00000206301] [ENSMUST00000206807]
Predicted Effect probably benign
Transcript: ENSMUST00000098346
AA Change: K742E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095949
Gene: ENSMUSG00000038886
AA Change: K742E

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
coiled coil region 44 75 N/A INTRINSIC
Pfam:Glyco_hydro_38 167 497 1.9e-109 PFAM
Alpha-mann_mid 502 588 1.4e-32 SMART
Pfam:Glyco_hydro_38C 648 1148 1.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205853
Predicted Effect probably benign
Transcript: ENSMUST00000206301
Predicted Effect probably benign
Transcript: ENSMUST00000206807
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Homozygous null males are infertile due to a defect during spermatogenesis involving the premature release of germ cells from the seminiferous tubules into the epididymis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230046K03Rik A G 10: 83,580,299 I818V possibly damaging Het
Arid4a T A 12: 71,060,115 Y320* probably null Het
Ash1l T A 3: 89,052,755 C2265S probably damaging Het
Atg4b T A 1: 93,785,972 C55* probably null Het
Cacna1s A T 1: 136,077,692 N405I probably benign Het
Capn11 A T 17: 45,633,399 D526E probably damaging Het
Ccdc188 A G 16: 18,218,380 R71G probably benign Het
Ccser2 G A 14: 36,896,263 R772W probably damaging Het
Cenpf T A 1: 189,682,403 E172D probably benign Het
Cep85 T C 4: 134,134,089 M627V probably null Het
Chd1 G A 17: 17,374,475 probably benign Het
Cnst A G 1: 179,610,194 H441R probably benign Het
Cyp2d11 G T 15: 82,390,437 T313N probably damaging Het
Cyp2g1 A G 7: 26,814,734 N255S possibly damaging Het
Dnah5 A G 15: 28,453,268 D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,327,352 probably null Het
Lama4 A G 10: 39,078,720 S1090G probably damaging Het
Malrd1 A G 2: 15,925,120 D1479G unknown Het
Mapk8 A T 14: 33,382,284 S392T probably benign Het
Mark3 T C 12: 111,592,683 I53T probably damaging Het
Mcmdc2 A G 1: 9,916,642 I219V probably benign Het
Mlycd A T 8: 119,407,593 E278V probably benign Het
Muc2 G T 7: 141,704,252 C29F Het
Mup20 T C 4: 62,053,484 I77V probably benign Het
Myh3 A G 11: 67,092,002 E849G probably damaging Het
Nedd4 A G 9: 72,686,107 N154S probably damaging Het
Olfr397 A T 11: 73,965,414 I269F probably benign Het
Pcdh7 A T 5: 57,720,336 N411I probably damaging Het
Plekhm1 A G 11: 103,395,060 I183T possibly damaging Het
Prkar2a G A 9: 108,692,511 V19M probably damaging Het
Prss35 T G 9: 86,755,613 N145K possibly damaging Het
Ranbp2 T A 10: 58,455,925 D251E possibly damaging Het
Rnf169 C A 7: 99,926,444 V315F probably damaging Het
Slc32a1 T C 2: 158,613,841 Y139H probably damaging Het
Slc5a2 T C 7: 128,271,156 V522A probably benign Het
Slc6a6 A T 6: 91,740,971 Q297L probably damaging Het
Sos2 A C 12: 69,598,824 Y914D probably damaging Het
Spata1 G T 3: 146,489,859 T32N possibly damaging Het
Srcap C T 7: 127,539,197 R1180C probably damaging Het
St14 A T 9: 31,131,625 M1K probably null Het
Tcaf1 T C 6: 42,675,302 T749A probably benign Het
Tcp1 T C 17: 12,922,734 probably null Het
Tle6 A G 10: 81,591,054 V576A probably damaging Het
Ttc25 G A 11: 100,563,676 G429E probably benign Het
Usp17lc T A 7: 103,418,200 M234K probably benign Het
Zdhhc18 A G 4: 133,613,854 L236P probably damaging Het
Zfp266 T C 9: 20,500,314 D189G probably benign Het
Zfp474 A T 18: 52,639,157 D294V probably damaging Het
Zfp568 T C 7: 30,023,333 F568L probably damaging Het
Zfp93 A G 7: 24,276,054 K488R probably benign Het
Other mutations in Man2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Man2a2 APN 7 80361132 missense possibly damaging 0.94
IGL01405:Man2a2 APN 7 80360934 missense probably benign 0.00
IGL01717:Man2a2 APN 7 80367365 missense probably damaging 1.00
IGL01843:Man2a2 APN 7 80362906 missense probably benign
IGL02212:Man2a2 APN 7 80362308 missense probably benign 0.00
IGL02383:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02434:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02493:Man2a2 APN 7 80369615 missense possibly damaging 0.68
IGL02528:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02529:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02530:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02534:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02869:Man2a2 APN 7 80363941 missense probably benign 0.00
IGL03084:Man2a2 APN 7 80352943 missense possibly damaging 0.88
IGL03088:Man2a2 APN 7 80359334 missense possibly damaging 0.91
IGL03377:Man2a2 APN 7 80359052 splice site probably null
IGL03412:Man2a2 APN 7 80366998 missense probably damaging 1.00
dugong UTSW 7 80360921 missense probably benign 0.12
R0112:Man2a2 UTSW 7 80358276 missense probably damaging 0.99
R0119:Man2a2 UTSW 7 80367405 missense probably damaging 1.00
R0646:Man2a2 UTSW 7 80363197 missense possibly damaging 0.53
R1184:Man2a2 UTSW 7 80362965 missense possibly damaging 0.79
R1445:Man2a2 UTSW 7 80368562 missense probably benign 0.06
R1626:Man2a2 UTSW 7 80367702 missense probably damaging 1.00
R1739:Man2a2 UTSW 7 80362438 missense probably benign 0.10
R1820:Man2a2 UTSW 7 80358933 missense probably benign 0.22
R2090:Man2a2 UTSW 7 80364110 unclassified probably benign
R2144:Man2a2 UTSW 7 80363516 missense probably damaging 1.00
R2150:Man2a2 UTSW 7 80367784 missense probably damaging 1.00
R3882:Man2a2 UTSW 7 80362315 missense possibly damaging 0.70
R4181:Man2a2 UTSW 7 80351739 missense possibly damaging 0.79
R4285:Man2a2 UTSW 7 80368619 missense probably damaging 1.00
R4302:Man2a2 UTSW 7 80351739 missense possibly damaging 0.79
R4440:Man2a2 UTSW 7 80351715 missense probably benign 0.37
R4494:Man2a2 UTSW 7 80359275 splice site probably null
R4564:Man2a2 UTSW 7 80368838 missense probably benign 0.00
R4631:Man2a2 UTSW 7 80362463 missense probably benign 0.10
R5328:Man2a2 UTSW 7 80368756 missense probably benign 0.06
R5329:Man2a2 UTSW 7 80361128 missense possibly damaging 0.82
R5468:Man2a2 UTSW 7 80352981 missense probably damaging 0.98
R5774:Man2a2 UTSW 7 80368358 missense probably damaging 1.00
R5824:Man2a2 UTSW 7 80353032 missense probably benign 0.00
R5915:Man2a2 UTSW 7 80360921 missense probably benign 0.12
R5937:Man2a2 UTSW 7 80363503 missense probably damaging 1.00
R6101:Man2a2 UTSW 7 80367001 missense probably damaging 1.00
R6105:Man2a2 UTSW 7 80367001 missense probably damaging 1.00
R6481:Man2a2 UTSW 7 80364071 missense probably damaging 0.99
R6592:Man2a2 UTSW 7 80353199 missense probably damaging 0.98
R6869:Man2a2 UTSW 7 80362945 missense probably benign 0.35
R6918:Man2a2 UTSW 7 80353192 missense possibly damaging 0.91
R7137:Man2a2 UTSW 7 80359751 missense probably benign 0.19
R7236:Man2a2 UTSW 7 80368905 missense probably damaging 1.00
R7496:Man2a2 UTSW 7 80352997 missense probably damaging 1.00
R7522:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7523:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7524:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7583:Man2a2 UTSW 7 80366944 missense probably damaging 1.00
R7681:Man2a2 UTSW 7 80351749 missense possibly damaging 0.49
R7828:Man2a2 UTSW 7 80366926 missense probably damaging 0.98
R7843:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7845:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7847:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7848:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7984:Man2a2 UTSW 7 80353308 missense probably damaging 0.99
R8296:Man2a2 UTSW 7 80368908 missense probably damaging 0.99
R8376:Man2a2 UTSW 7 80360923 nonsense probably null
R8515:Man2a2 UTSW 7 80368290 missense possibly damaging 0.88
X0057:Man2a2 UTSW 7 80362324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCTCTGTGAGTCAGGTGAC -3'
(R):5'- AGGGCTCAGTGCTTAGCTTC -3'

Sequencing Primer
(F):5'- GCAGGAACAGCTATCCACAAG -3'
(R):5'- CTCAGTGCTTAGCTTCGGAAAG -3'
Posted On2020-07-13