Incidental Mutation 'R8194:Rnf169'
ID635344
Institutional Source Beutler Lab
Gene Symbol Rnf169
Ensembl Gene ENSMUSG00000058761
Gene Namering finger protein 169
Synonyms2900057K09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R8194 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location99920254-99980448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 99926444 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 315 (V315F)
Ref Sequence ENSEMBL: ENSMUSP00000079631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080817]
Predicted Effect probably damaging
Transcript: ENSMUST00000080817
AA Change: V315F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079631
Gene: ENSMUSG00000058761
AA Change: V315F

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
low complexity region 32 46 N/A INTRINSIC
RING 61 96 3.16e-1 SMART
Blast:RING 133 176 7e-8 BLAST
low complexity region 302 314 N/A INTRINSIC
low complexity region 649 661 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230046K03Rik A G 10: 83,580,299 I818V possibly damaging Het
Arid4a T A 12: 71,060,115 Y320* probably null Het
Ash1l T A 3: 89,052,755 C2265S probably damaging Het
Atg4b T A 1: 93,785,972 C55* probably null Het
Cacna1s A T 1: 136,077,692 N405I probably benign Het
Capn11 A T 17: 45,633,399 D526E probably damaging Het
Ccdc188 A G 16: 18,218,380 R71G probably benign Het
Ccser2 G A 14: 36,896,263 R772W probably damaging Het
Cenpf T A 1: 189,682,403 E172D probably benign Het
Cep85 T C 4: 134,134,089 M627V probably null Het
Chd1 G A 17: 17,374,475 probably benign Het
Cnst A G 1: 179,610,194 H441R probably benign Het
Cyp2d11 G T 15: 82,390,437 T313N probably damaging Het
Cyp2g1 A G 7: 26,814,734 N255S possibly damaging Het
Dnah5 A G 15: 28,453,268 D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,327,352 probably null Het
Lama4 A G 10: 39,078,720 S1090G probably damaging Het
Malrd1 A G 2: 15,925,120 D1479G unknown Het
Man2a2 T C 7: 80,361,018 K742E probably benign Het
Mapk8 A T 14: 33,382,284 S392T probably benign Het
Mark3 T C 12: 111,592,683 I53T probably damaging Het
Mcmdc2 A G 1: 9,916,642 I219V probably benign Het
Mlycd A T 8: 119,407,593 E278V probably benign Het
Muc2 G T 7: 141,704,252 C29F Het
Mup20 T C 4: 62,053,484 I77V probably benign Het
Myh3 A G 11: 67,092,002 E849G probably damaging Het
Nedd4 A G 9: 72,686,107 N154S probably damaging Het
Olfr397 A T 11: 73,965,414 I269F probably benign Het
Pcdh7 A T 5: 57,720,336 N411I probably damaging Het
Plekhm1 A G 11: 103,395,060 I183T possibly damaging Het
Prkar2a G A 9: 108,692,511 V19M probably damaging Het
Prss35 T G 9: 86,755,613 N145K possibly damaging Het
Ranbp2 T A 10: 58,455,925 D251E possibly damaging Het
Slc32a1 T C 2: 158,613,841 Y139H probably damaging Het
Slc5a2 T C 7: 128,271,156 V522A probably benign Het
Slc6a6 A T 6: 91,740,971 Q297L probably damaging Het
Sos2 A C 12: 69,598,824 Y914D probably damaging Het
Spata1 G T 3: 146,489,859 T32N possibly damaging Het
Srcap C T 7: 127,539,197 R1180C probably damaging Het
St14 A T 9: 31,131,625 M1K probably null Het
Tcaf1 T C 6: 42,675,302 T749A probably benign Het
Tcp1 T C 17: 12,922,734 probably null Het
Tle6 A G 10: 81,591,054 V576A probably damaging Het
Ttc25 G A 11: 100,563,676 G429E probably benign Het
Usp17lc T A 7: 103,418,200 M234K probably benign Het
Zdhhc18 A G 4: 133,613,854 L236P probably damaging Het
Zfp266 T C 9: 20,500,314 D189G probably benign Het
Zfp474 A T 18: 52,639,157 D294V probably damaging Het
Zfp568 T C 7: 30,023,333 F568L probably damaging Het
Zfp93 A G 7: 24,276,054 K488R probably benign Het
Other mutations in Rnf169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Rnf169 APN 7 99955484 missense probably damaging 1.00
IGL02344:Rnf169 APN 7 99926435 missense probably damaging 1.00
IGL03066:Rnf169 APN 7 99925553 missense possibly damaging 0.85
R0201:Rnf169 UTSW 7 99926003 missense possibly damaging 0.85
R1087:Rnf169 UTSW 7 99942997 missense probably benign 0.01
R1289:Rnf169 UTSW 7 99925736 missense probably benign 0.01
R1476:Rnf169 UTSW 7 99925328 missense possibly damaging 0.72
R1912:Rnf169 UTSW 7 99926254 missense probably damaging 1.00
R1964:Rnf169 UTSW 7 99925525 missense probably damaging 1.00
R2057:Rnf169 UTSW 7 99925408 missense probably damaging 1.00
R2342:Rnf169 UTSW 7 99925445 missense possibly damaging 0.87
R4755:Rnf169 UTSW 7 99925723 missense probably benign 0.01
R4801:Rnf169 UTSW 7 99926446 missense probably damaging 1.00
R4802:Rnf169 UTSW 7 99926446 missense probably damaging 1.00
R5391:Rnf169 UTSW 7 99935160 critical splice donor site probably null
R5395:Rnf169 UTSW 7 99935160 critical splice donor site probably null
R5643:Rnf169 UTSW 7 99927131 missense possibly damaging 0.85
R5817:Rnf169 UTSW 7 99925769 missense probably benign 0.02
R5952:Rnf169 UTSW 7 99925633 missense probably damaging 1.00
R6009:Rnf169 UTSW 7 99927123 missense possibly damaging 0.92
R6453:Rnf169 UTSW 7 99935227 missense probably benign 0.01
R7238:Rnf169 UTSW 7 99925747 missense probably benign 0.10
R7500:Rnf169 UTSW 7 99980238 missense probably damaging 0.99
Z1177:Rnf169 UTSW 7 99925861 missense not run
Predicted Primers PCR Primer
(F):5'- CAGACGATGGGCTTGAAGTG -3'
(R):5'- CCCACATCTAAAGGACTTACGTAG -3'

Sequencing Primer
(F):5'- AAGTGGTTTAGCTCTTCAGAGATGC -3'
(R):5'- AGCACTTGTTCTTGCAGAGACCTAG -3'
Posted On2020-07-13