Incidental Mutation 'R8194:Rnf169'
ID 635344
Institutional Source Beutler Lab
Gene Symbol Rnf169
Ensembl Gene ENSMUSG00000058761
Gene Name ring finger protein 169
Synonyms 2900057K09Rik
MMRRC Submission 067617-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.155) question?
Stock # R8194 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 99569461-99629655 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 99575651 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 315 (V315F)
Ref Sequence ENSEMBL: ENSMUSP00000079631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080817]
AlphaFold E9Q7F2
Predicted Effect probably damaging
Transcript: ENSMUST00000080817
AA Change: V315F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079631
Gene: ENSMUSG00000058761
AA Change: V315F

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
low complexity region 32 46 N/A INTRINSIC
RING 61 96 3.16e-1 SMART
Blast:RING 133 176 7e-8 BLAST
low complexity region 302 314 N/A INTRINSIC
low complexity region 649 661 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4a T A 12: 71,106,889 (GRCm39) Y320* probably null Het
Ash1l T A 3: 88,960,062 (GRCm39) C2265S probably damaging Het
Atg4b T A 1: 93,713,694 (GRCm39) C55* probably null Het
Cacna1s A T 1: 136,005,430 (GRCm39) N405I probably benign Het
Capn11 A T 17: 45,944,325 (GRCm39) D526E probably damaging Het
Ccdc188 A G 16: 18,036,244 (GRCm39) R71G probably benign Het
Ccser2 G A 14: 36,618,220 (GRCm39) R772W probably damaging Het
Cenpf T A 1: 189,414,600 (GRCm39) E172D probably benign Het
Cep85 T C 4: 133,861,400 (GRCm39) M627V probably null Het
Chd1 G A 17: 17,594,737 (GRCm39) probably benign Het
Cnst A G 1: 179,437,759 (GRCm39) H441R probably benign Het
Cyp2d11 G T 15: 82,274,638 (GRCm39) T313N probably damaging Het
Cyp2g1 A G 7: 26,514,159 (GRCm39) N255S possibly damaging Het
Dnah5 A G 15: 28,453,414 (GRCm39) D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 75,874,624 (GRCm39) probably benign Het
Fcnb C T 2: 27,968,330 (GRCm39) S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,217,364 (GRCm39) probably null Het
Lama4 A G 10: 38,954,716 (GRCm39) S1090G probably damaging Het
Malrd1 A G 2: 15,929,931 (GRCm39) D1479G unknown Het
Man2a2 T C 7: 80,010,766 (GRCm39) K742E probably benign Het
Mapk8 A T 14: 33,104,241 (GRCm39) S392T probably benign Het
Mark3 T C 12: 111,559,117 (GRCm39) I53T probably damaging Het
Mcmdc2 A G 1: 9,986,867 (GRCm39) I219V probably benign Het
Mlycd A T 8: 120,134,332 (GRCm39) E278V probably benign Het
Muc2 G T 7: 141,290,801 (GRCm39) C29F Het
Mup20 T C 4: 61,971,721 (GRCm39) I77V probably benign Het
Myh3 A G 11: 66,982,828 (GRCm39) E849G probably damaging Het
Nedd4 A G 9: 72,593,389 (GRCm39) N154S probably damaging Het
Odad4 G A 11: 100,454,502 (GRCm39) G429E probably benign Het
Or1e1f A T 11: 73,856,240 (GRCm39) I269F probably benign Het
Pcdh7 A T 5: 57,877,678 (GRCm39) N411I probably damaging Het
Plekhm1 A G 11: 103,285,886 (GRCm39) I183T possibly damaging Het
Prkar2a G A 9: 108,569,710 (GRCm39) V19M probably damaging Het
Prss35 T G 9: 86,637,666 (GRCm39) N145K possibly damaging Het
Ranbp2 T A 10: 58,291,747 (GRCm39) D251E possibly damaging Het
Slc32a1 T C 2: 158,455,761 (GRCm39) Y139H probably damaging Het
Slc5a2 T C 7: 127,870,328 (GRCm39) V522A probably benign Het
Slc6a6 A T 6: 91,717,952 (GRCm39) Q297L probably damaging Het
Sos2 A C 12: 69,645,598 (GRCm39) Y914D probably damaging Het
Spata1 G T 3: 146,195,614 (GRCm39) T32N possibly damaging Het
Srcap C T 7: 127,138,369 (GRCm39) R1180C probably damaging Het
St14 A T 9: 31,042,921 (GRCm39) M1K probably null Het
Tcaf1 T C 6: 42,652,236 (GRCm39) T749A probably benign Het
Tcp1 T C 17: 13,141,621 (GRCm39) probably null Het
Tle6 A G 10: 81,426,888 (GRCm39) V576A probably damaging Het
Usp17lc T A 7: 103,067,407 (GRCm39) M234K probably benign Het
Washc4 A G 10: 83,416,163 (GRCm39) I818V possibly damaging Het
Zdhhc18 A G 4: 133,341,165 (GRCm39) L236P probably damaging Het
Zfp266 T C 9: 20,411,610 (GRCm39) D189G probably benign Het
Zfp474 A T 18: 52,772,229 (GRCm39) D294V probably damaging Het
Zfp568 T C 7: 29,722,758 (GRCm39) F568L probably damaging Het
Zfp93 A G 7: 23,975,479 (GRCm39) K488R probably benign Het
Other mutations in Rnf169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Rnf169 APN 7 99,604,691 (GRCm39) missense probably damaging 1.00
IGL02344:Rnf169 APN 7 99,575,642 (GRCm39) missense probably damaging 1.00
IGL03066:Rnf169 APN 7 99,574,760 (GRCm39) missense possibly damaging 0.85
R0201:Rnf169 UTSW 7 99,575,210 (GRCm39) missense possibly damaging 0.85
R1087:Rnf169 UTSW 7 99,592,204 (GRCm39) missense probably benign 0.01
R1289:Rnf169 UTSW 7 99,574,943 (GRCm39) missense probably benign 0.01
R1476:Rnf169 UTSW 7 99,574,535 (GRCm39) missense possibly damaging 0.72
R1912:Rnf169 UTSW 7 99,575,461 (GRCm39) missense probably damaging 1.00
R1964:Rnf169 UTSW 7 99,574,732 (GRCm39) missense probably damaging 1.00
R2057:Rnf169 UTSW 7 99,574,615 (GRCm39) missense probably damaging 1.00
R2342:Rnf169 UTSW 7 99,574,652 (GRCm39) missense possibly damaging 0.87
R4755:Rnf169 UTSW 7 99,574,930 (GRCm39) missense probably benign 0.01
R4801:Rnf169 UTSW 7 99,575,653 (GRCm39) missense probably damaging 1.00
R4802:Rnf169 UTSW 7 99,575,653 (GRCm39) missense probably damaging 1.00
R5391:Rnf169 UTSW 7 99,584,367 (GRCm39) critical splice donor site probably null
R5395:Rnf169 UTSW 7 99,584,367 (GRCm39) critical splice donor site probably null
R5643:Rnf169 UTSW 7 99,576,338 (GRCm39) missense possibly damaging 0.85
R5817:Rnf169 UTSW 7 99,574,976 (GRCm39) missense probably benign 0.02
R5952:Rnf169 UTSW 7 99,574,840 (GRCm39) missense probably damaging 1.00
R6009:Rnf169 UTSW 7 99,576,330 (GRCm39) missense possibly damaging 0.92
R6453:Rnf169 UTSW 7 99,584,434 (GRCm39) missense probably benign 0.01
R7238:Rnf169 UTSW 7 99,574,954 (GRCm39) missense probably benign 0.10
R7500:Rnf169 UTSW 7 99,629,445 (GRCm39) missense probably damaging 0.99
R9227:Rnf169 UTSW 7 99,574,699 (GRCm39) missense possibly damaging 0.82
R9469:Rnf169 UTSW 7 99,575,567 (GRCm39) missense possibly damaging 0.92
R9548:Rnf169 UTSW 7 99,574,690 (GRCm39) missense probably damaging 1.00
R9729:Rnf169 UTSW 7 99,575,477 (GRCm39) missense probably damaging 1.00
Z1177:Rnf169 UTSW 7 99,575,068 (GRCm39) missense not run
Predicted Primers PCR Primer
(F):5'- CAGACGATGGGCTTGAAGTG -3'
(R):5'- CCCACATCTAAAGGACTTACGTAG -3'

Sequencing Primer
(F):5'- AAGTGGTTTAGCTCTTCAGAGATGC -3'
(R):5'- AGCACTTGTTCTTGCAGAGACCTAG -3'
Posted On 2020-07-13