Incidental Mutation 'R8194:Usp17lc'
ID635345
Institutional Source Beutler Lab
Gene Symbol Usp17lc
Ensembl Gene ENSMUSG00000058976
Gene Nameubiquitin specific peptidase 17-like C
SynonymsDub2, Usp17l5, Dub2b, Dub-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8194 (G1)
Quality Score135.008
Status Not validated
Chromosome7
Chromosomal Location103415072-103419880 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103418200 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 234 (M234K)
Ref Sequence ENSEMBL: ENSMUSP00000078323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079348] [ENSMUST00000106892]
Predicted Effect probably benign
Transcript: ENSMUST00000079348
AA Change: M234K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000078323
Gene: ENSMUSG00000058976
AA Change: M234K

DomainStartEndE-ValueType
Pfam:UCH 50 345 3.8e-54 PFAM
Pfam:UCH_1 51 327 3.5e-25 PFAM
low complexity region 374 385 N/A INTRINSIC
low complexity region 529 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106892
AA Change: M234K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102505
Gene: ENSMUSG00000058976
AA Change: M234K

DomainStartEndE-ValueType
Pfam:UCH 50 345 1.3e-60 PFAM
Pfam:UCH_1 51 327 5.5e-30 PFAM
low complexity region 374 385 N/A INTRINSIC
low complexity region 529 539 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic elthality before implantation, failure to hatch from the zona pellucida, decreased cell proliferation and increased apoptosis. Mice heterozygous for this allele exhibit abnormal body, testis and thymus weight and reduced sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230046K03Rik A G 10: 83,580,299 I818V possibly damaging Het
Arid4a T A 12: 71,060,115 Y320* probably null Het
Ash1l T A 3: 89,052,755 C2265S probably damaging Het
Atg4b T A 1: 93,785,972 C55* probably null Het
Cacna1s A T 1: 136,077,692 N405I probably benign Het
Capn11 A T 17: 45,633,399 D526E probably damaging Het
Ccdc188 A G 16: 18,218,380 R71G probably benign Het
Ccser2 G A 14: 36,896,263 R772W probably damaging Het
Cenpf T A 1: 189,682,403 E172D probably benign Het
Cep85 T C 4: 134,134,089 M627V probably null Het
Chd1 G A 17: 17,374,475 probably benign Het
Cnst A G 1: 179,610,194 H441R probably benign Het
Cyp2d11 G T 15: 82,390,437 T313N probably damaging Het
Cyp2g1 A G 7: 26,814,734 N255S possibly damaging Het
Dnah5 A G 15: 28,453,268 D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,327,352 probably null Het
Lama4 A G 10: 39,078,720 S1090G probably damaging Het
Malrd1 A G 2: 15,925,120 D1479G unknown Het
Man2a2 T C 7: 80,361,018 K742E probably benign Het
Mapk8 A T 14: 33,382,284 S392T probably benign Het
Mark3 T C 12: 111,592,683 I53T probably damaging Het
Mcmdc2 A G 1: 9,916,642 I219V probably benign Het
Mlycd A T 8: 119,407,593 E278V probably benign Het
Muc2 G T 7: 141,704,252 C29F Het
Mup20 T C 4: 62,053,484 I77V probably benign Het
Myh3 A G 11: 67,092,002 E849G probably damaging Het
Nedd4 A G 9: 72,686,107 N154S probably damaging Het
Olfr397 A T 11: 73,965,414 I269F probably benign Het
Pcdh7 A T 5: 57,720,336 N411I probably damaging Het
Plekhm1 A G 11: 103,395,060 I183T possibly damaging Het
Prkar2a G A 9: 108,692,511 V19M probably damaging Het
Prss35 T G 9: 86,755,613 N145K possibly damaging Het
Ranbp2 T A 10: 58,455,925 D251E possibly damaging Het
Rnf169 C A 7: 99,926,444 V315F probably damaging Het
Slc32a1 T C 2: 158,613,841 Y139H probably damaging Het
Slc5a2 T C 7: 128,271,156 V522A probably benign Het
Slc6a6 A T 6: 91,740,971 Q297L probably damaging Het
Sos2 A C 12: 69,598,824 Y914D probably damaging Het
Spata1 G T 3: 146,489,859 T32N possibly damaging Het
Srcap C T 7: 127,539,197 R1180C probably damaging Het
St14 A T 9: 31,131,625 M1K probably null Het
Tcaf1 T C 6: 42,675,302 T749A probably benign Het
Tcp1 T C 17: 12,922,734 probably null Het
Tle6 A G 10: 81,591,054 V576A probably damaging Het
Ttc25 G A 11: 100,563,676 G429E probably benign Het
Zdhhc18 A G 4: 133,613,854 L236P probably damaging Het
Zfp266 T C 9: 20,500,314 D189G probably benign Het
Zfp474 A T 18: 52,639,157 D294V probably damaging Het
Zfp568 T C 7: 30,023,333 F568L probably damaging Het
Zfp93 A G 7: 24,276,054 K488R probably benign Het
Other mutations in Usp17lc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Usp17lc APN 7 103418941 missense possibly damaging 0.74
IGL00499:Usp17lc APN 7 103418466 missense probably damaging 1.00
IGL00499:Usp17lc APN 7 103418465 missense probably damaging 1.00
IGL01446:Usp17lc APN 7 103418444 missense probably benign 0.00
R1466:Usp17lc UTSW 7 103418941 missense possibly damaging 0.74
R1466:Usp17lc UTSW 7 103418941 missense possibly damaging 0.74
R1584:Usp17lc UTSW 7 103418941 missense possibly damaging 0.74
R1754:Usp17lc UTSW 7 103418848 missense probably benign 0.01
R2987:Usp17lc UTSW 7 103418302 missense probably damaging 0.99
R3969:Usp17lc UTSW 7 103418419 missense probably damaging 1.00
R4661:Usp17lc UTSW 7 103418590 missense probably benign 0.00
R5118:Usp17lc UTSW 7 103418661 missense probably benign 0.05
R5413:Usp17lc UTSW 7 103418556 missense probably benign
R6962:Usp17lc UTSW 7 103418911 missense probably benign 0.00
R7412:Usp17lc UTSW 7 103418368 missense probably damaging 1.00
R7638:Usp17lc UTSW 7 103418499 missense probably damaging 1.00
R7748:Usp17lc UTSW 7 103418481 missense probably damaging 1.00
R8303:Usp17lc UTSW 7 103418182 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGTGGAGGTCTCAGATCAAGTG -3'
(R):5'- TCCACTGTGACAAGTCGCAC -3'

Sequencing Primer
(F):5'- AGATCAAGTGTCTCCATTGCCAGG -3'
(R):5'- GTGACAAGTCGCACCTTCATG -3'
Posted On2020-07-13