Incidental Mutation 'R8194:Srcap'
ID 635346
Institutional Source Beutler Lab
Gene Symbol Srcap
Ensembl Gene ENSMUSG00000053877
Gene Name Snf2-related CREBBP activator protein
Synonyms D030022P06Rik, B930091H02Rik, F630004O05Rik
MMRRC Submission 067617-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # R8194 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 127111155-127160391 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 127138369 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 1180 (R1180C)
Ref Sequence ENSEMBL: ENSMUSP00000140036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066582] [ENSMUST00000186672] [ENSMUST00000186954] [ENSMUST00000187040] [ENSMUST00000189629] [ENSMUST00000190390]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000066582
SMART Domains Protein: ENSMUSP00000063817
Gene: ENSMUSG00000053877

DomainStartEndE-ValueType
Pfam:HSA 108 177 1.1e-22 PFAM
low complexity region 238 261 N/A INTRINSIC
low complexity region 264 291 N/A INTRINSIC
low complexity region 303 328 N/A INTRINSIC
low complexity region 377 400 N/A INTRINSIC
low complexity region 460 538 N/A INTRINSIC
low complexity region 557 572 N/A INTRINSIC
DEXDc 606 798 1.22e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186672
AA Change: R1180C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140395
Gene: ENSMUSG00000053877
AA Change: R1180C

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
HSA 125 196 5.4e-25 SMART
low complexity region 257 280 N/A INTRINSIC
low complexity region 283 310 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 396 420 N/A INTRINSIC
low complexity region 480 558 N/A INTRINSIC
low complexity region 577 592 N/A INTRINSIC
DEXDc 626 818 5e-37 SMART
low complexity region 993 1001 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
low complexity region 1150 1178 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186954
SMART Domains Protein: ENSMUSP00000139536
Gene: ENSMUSG00000053877

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
HSA 125 196 5.4e-25 SMART
low complexity region 257 280 N/A INTRINSIC
low complexity region 283 310 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 396 420 N/A INTRINSIC
low complexity region 480 558 N/A INTRINSIC
low complexity region 577 592 N/A INTRINSIC
DEXDc 626 818 5e-37 SMART
low complexity region 993 1001 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
low complexity region 1175 1194 N/A INTRINSIC
internal_repeat_1 1202 1245 2.24e-5 PROSPERO
low complexity region 1274 1302 N/A INTRINSIC
low complexity region 1304 1318 N/A INTRINSIC
low complexity region 1335 1353 N/A INTRINSIC
low complexity region 1355 1370 N/A INTRINSIC
low complexity region 1414 1441 N/A INTRINSIC
low complexity region 1452 1466 N/A INTRINSIC
low complexity region 1504 1533 N/A INTRINSIC
internal_repeat_1 1536 1579 2.24e-5 PROSPERO
internal_repeat_2 1537 1559 5.66e-5 PROSPERO
internal_repeat_2 1569 1589 5.66e-5 PROSPERO
low complexity region 1590 1607 N/A INTRINSIC
low complexity region 1609 1627 N/A INTRINSIC
low complexity region 1644 1678 N/A INTRINSIC
low complexity region 1713 1726 N/A INTRINSIC
low complexity region 1828 1840 N/A INTRINSIC
HELICc 1916 1999 1.2e-28 SMART
low complexity region 2058 2078 N/A INTRINSIC
coiled coil region 2166 2201 N/A INTRINSIC
low complexity region 2282 2348 N/A INTRINSIC
low complexity region 2374 2409 N/A INTRINSIC
low complexity region 2588 2600 N/A INTRINSIC
low complexity region 2642 2657 N/A INTRINSIC
low complexity region 2685 2712 N/A INTRINSIC
AT_hook 2745 2757 2.4e-2 SMART
low complexity region 2797 2817 N/A INTRINSIC
AT_hook 2825 2837 2.6e-3 SMART
low complexity region 2838 2849 N/A INTRINSIC
low complexity region 2858 2885 N/A INTRINSIC
AT_hook 2889 2901 2.4e-3 SMART
low complexity region 2934 2945 N/A INTRINSIC
low complexity region 2946 2956 N/A INTRINSIC
low complexity region 3043 3079 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187040
AA Change: R1180C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140036
Gene: ENSMUSG00000053877
AA Change: R1180C

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
HSA 125 196 5.4e-25 SMART
low complexity region 257 280 N/A INTRINSIC
low complexity region 283 310 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 396 420 N/A INTRINSIC
low complexity region 480 558 N/A INTRINSIC
low complexity region 577 592 N/A INTRINSIC
DEXDc 626 818 5e-37 SMART
low complexity region 993 1001 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
low complexity region 1150 1178 N/A INTRINSIC
low complexity region 1277 1305 N/A INTRINSIC
low complexity region 1332 1351 N/A INTRINSIC
internal_repeat_1 1359 1402 1.78e-5 PROSPERO
low complexity region 1431 1459 N/A INTRINSIC
low complexity region 1461 1475 N/A INTRINSIC
low complexity region 1492 1510 N/A INTRINSIC
low complexity region 1512 1527 N/A INTRINSIC
low complexity region 1571 1598 N/A INTRINSIC
low complexity region 1609 1623 N/A INTRINSIC
low complexity region 1661 1690 N/A INTRINSIC
internal_repeat_1 1693 1736 1.78e-5 PROSPERO
internal_repeat_2 1694 1716 4.56e-5 PROSPERO
internal_repeat_2 1726 1746 4.56e-5 PROSPERO
low complexity region 1747 1764 N/A INTRINSIC
low complexity region 1766 1784 N/A INTRINSIC
low complexity region 1801 1835 N/A INTRINSIC
low complexity region 1870 1883 N/A INTRINSIC
low complexity region 1985 1997 N/A INTRINSIC
HELICc 2073 2156 1.2e-28 SMART
low complexity region 2215 2235 N/A INTRINSIC
coiled coil region 2323 2358 N/A INTRINSIC
low complexity region 2439 2505 N/A INTRINSIC
low complexity region 2531 2566 N/A INTRINSIC
low complexity region 2745 2757 N/A INTRINSIC
low complexity region 2799 2814 N/A INTRINSIC
low complexity region 2842 2869 N/A INTRINSIC
AT_hook 2902 2914 2.4e-2 SMART
low complexity region 2954 2974 N/A INTRINSIC
AT_hook 2982 2994 2.6e-3 SMART
low complexity region 2995 3006 N/A INTRINSIC
low complexity region 3015 3042 N/A INTRINSIC
AT_hook 3046 3058 2.4e-3 SMART
low complexity region 3091 3102 N/A INTRINSIC
low complexity region 3103 3113 N/A INTRINSIC
low complexity region 3200 3236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189629
SMART Domains Protein: ENSMUSP00000139644
Gene: ENSMUSG00000107023

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
HSA 106 177 5.4e-25 SMART
low complexity region 238 261 N/A INTRINSIC
low complexity region 264 291 N/A INTRINSIC
low complexity region 303 328 N/A INTRINSIC
low complexity region 377 401 N/A INTRINSIC
low complexity region 461 539 N/A INTRINSIC
low complexity region 558 573 N/A INTRINSIC
DEXDc 607 799 5e-37 SMART
low complexity region 974 982 N/A INTRINSIC
low complexity region 1008 1023 N/A INTRINSIC
low complexity region 1027 1044 N/A INTRINSIC
low complexity region 1156 1175 N/A INTRINSIC
internal_repeat_1 1183 1226 2e-5 PROSPERO
low complexity region 1255 1283 N/A INTRINSIC
low complexity region 1285 1299 N/A INTRINSIC
low complexity region 1316 1334 N/A INTRINSIC
low complexity region 1336 1351 N/A INTRINSIC
low complexity region 1395 1422 N/A INTRINSIC
low complexity region 1433 1447 N/A INTRINSIC
low complexity region 1485 1514 N/A INTRINSIC
internal_repeat_1 1517 1560 2e-5 PROSPERO
internal_repeat_2 1518 1540 5.08e-5 PROSPERO
internal_repeat_2 1550 1570 5.08e-5 PROSPERO
low complexity region 1571 1588 N/A INTRINSIC
low complexity region 1590 1608 N/A INTRINSIC
low complexity region 1625 1659 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
low complexity region 1809 1821 N/A INTRINSIC
HELICc 1897 1980 1.2e-28 SMART
low complexity region 2039 2059 N/A INTRINSIC
coiled coil region 2147 2182 N/A INTRINSIC
low complexity region 2263 2329 N/A INTRINSIC
low complexity region 2355 2390 N/A INTRINSIC
low complexity region 2569 2581 N/A INTRINSIC
low complexity region 2623 2638 N/A INTRINSIC
low complexity region 2666 2693 N/A INTRINSIC
AT_hook 2726 2738 2.4e-2 SMART
low complexity region 2778 2798 N/A INTRINSIC
AT_hook 2806 2818 2.6e-3 SMART
low complexity region 2819 2830 N/A INTRINSIC
low complexity region 2839 2866 N/A INTRINSIC
AT_hook 2870 2882 2.4e-3 SMART
low complexity region 2915 2926 N/A INTRINSIC
low complexity region 2927 2937 N/A INTRINSIC
low complexity region 3024 3060 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190390
AA Change: R1180C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139399
Gene: ENSMUSG00000053877
AA Change: R1180C

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
HSA 125 196 5.4e-25 SMART
low complexity region 257 280 N/A INTRINSIC
low complexity region 283 310 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 396 420 N/A INTRINSIC
low complexity region 480 558 N/A INTRINSIC
low complexity region 577 592 N/A INTRINSIC
DEXDc 626 818 5e-37 SMART
low complexity region 993 1001 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
low complexity region 1150 1178 N/A INTRINSIC
low complexity region 1271 1290 N/A INTRINSIC
internal_repeat_1 1298 1341 2.01e-5 PROSPERO
low complexity region 1370 1398 N/A INTRINSIC
low complexity region 1400 1414 N/A INTRINSIC
low complexity region 1431 1449 N/A INTRINSIC
low complexity region 1451 1466 N/A INTRINSIC
low complexity region 1510 1537 N/A INTRINSIC
low complexity region 1548 1562 N/A INTRINSIC
low complexity region 1600 1629 N/A INTRINSIC
internal_repeat_1 1632 1675 2.01e-5 PROSPERO
internal_repeat_2 1633 1655 5.11e-5 PROSPERO
internal_repeat_2 1665 1685 5.11e-5 PROSPERO
low complexity region 1686 1703 N/A INTRINSIC
low complexity region 1705 1723 N/A INTRINSIC
low complexity region 1740 1774 N/A INTRINSIC
low complexity region 1809 1822 N/A INTRINSIC
low complexity region 1924 1936 N/A INTRINSIC
HELICc 2012 2095 1.2e-28 SMART
low complexity region 2154 2174 N/A INTRINSIC
coiled coil region 2262 2297 N/A INTRINSIC
low complexity region 2378 2444 N/A INTRINSIC
low complexity region 2470 2505 N/A INTRINSIC
low complexity region 2684 2696 N/A INTRINSIC
low complexity region 2738 2753 N/A INTRINSIC
low complexity region 2781 2808 N/A INTRINSIC
AT_hook 2841 2853 2.4e-2 SMART
low complexity region 2893 2913 N/A INTRINSIC
AT_hook 2921 2933 2.6e-3 SMART
low complexity region 2934 2945 N/A INTRINSIC
low complexity region 2954 2981 N/A INTRINSIC
AT_hook 2985 2997 2.4e-3 SMART
low complexity region 3030 3041 N/A INTRINSIC
low complexity region 3042 3052 N/A INTRINSIC
low complexity region 3139 3175 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the core catalytic component of the multiprotein chromatin-remodeling SRCAP complex. The encoded protein is an ATPase that is necessary for the incorporation of the histone variant H2A.Z into nucleosomes. It can function as a transcriptional activator in Notch-mediated, CREB-mediated and steroid receptor-mediated transcription. Mutations in this gene cause Floating-Harbor syndrome, a rare disorder characterized by short stature, language deficits and dysmorphic facial features. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4a T A 12: 71,106,889 (GRCm39) Y320* probably null Het
Ash1l T A 3: 88,960,062 (GRCm39) C2265S probably damaging Het
Atg4b T A 1: 93,713,694 (GRCm39) C55* probably null Het
Cacna1s A T 1: 136,005,430 (GRCm39) N405I probably benign Het
Capn11 A T 17: 45,944,325 (GRCm39) D526E probably damaging Het
Ccdc188 A G 16: 18,036,244 (GRCm39) R71G probably benign Het
Ccser2 G A 14: 36,618,220 (GRCm39) R772W probably damaging Het
Cenpf T A 1: 189,414,600 (GRCm39) E172D probably benign Het
Cep85 T C 4: 133,861,400 (GRCm39) M627V probably null Het
Chd1 G A 17: 17,594,737 (GRCm39) probably benign Het
Cnst A G 1: 179,437,759 (GRCm39) H441R probably benign Het
Cyp2d11 G T 15: 82,274,638 (GRCm39) T313N probably damaging Het
Cyp2g1 A G 7: 26,514,159 (GRCm39) N255S possibly damaging Het
Dnah5 A G 15: 28,453,414 (GRCm39) D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 75,874,624 (GRCm39) probably benign Het
Fcnb C T 2: 27,968,330 (GRCm39) S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,217,364 (GRCm39) probably null Het
Lama4 A G 10: 38,954,716 (GRCm39) S1090G probably damaging Het
Malrd1 A G 2: 15,929,931 (GRCm39) D1479G unknown Het
Man2a2 T C 7: 80,010,766 (GRCm39) K742E probably benign Het
Mapk8 A T 14: 33,104,241 (GRCm39) S392T probably benign Het
Mark3 T C 12: 111,559,117 (GRCm39) I53T probably damaging Het
Mcmdc2 A G 1: 9,986,867 (GRCm39) I219V probably benign Het
Mlycd A T 8: 120,134,332 (GRCm39) E278V probably benign Het
Muc2 G T 7: 141,290,801 (GRCm39) C29F Het
Mup20 T C 4: 61,971,721 (GRCm39) I77V probably benign Het
Myh3 A G 11: 66,982,828 (GRCm39) E849G probably damaging Het
Nedd4 A G 9: 72,593,389 (GRCm39) N154S probably damaging Het
Odad4 G A 11: 100,454,502 (GRCm39) G429E probably benign Het
Or1e1f A T 11: 73,856,240 (GRCm39) I269F probably benign Het
Pcdh7 A T 5: 57,877,678 (GRCm39) N411I probably damaging Het
Plekhm1 A G 11: 103,285,886 (GRCm39) I183T possibly damaging Het
Prkar2a G A 9: 108,569,710 (GRCm39) V19M probably damaging Het
Prss35 T G 9: 86,637,666 (GRCm39) N145K possibly damaging Het
Ranbp2 T A 10: 58,291,747 (GRCm39) D251E possibly damaging Het
Rnf169 C A 7: 99,575,651 (GRCm39) V315F probably damaging Het
Slc32a1 T C 2: 158,455,761 (GRCm39) Y139H probably damaging Het
Slc5a2 T C 7: 127,870,328 (GRCm39) V522A probably benign Het
Slc6a6 A T 6: 91,717,952 (GRCm39) Q297L probably damaging Het
Sos2 A C 12: 69,645,598 (GRCm39) Y914D probably damaging Het
Spata1 G T 3: 146,195,614 (GRCm39) T32N possibly damaging Het
St14 A T 9: 31,042,921 (GRCm39) M1K probably null Het
Tcaf1 T C 6: 42,652,236 (GRCm39) T749A probably benign Het
Tcp1 T C 17: 13,141,621 (GRCm39) probably null Het
Tle6 A G 10: 81,426,888 (GRCm39) V576A probably damaging Het
Usp17lc T A 7: 103,067,407 (GRCm39) M234K probably benign Het
Washc4 A G 10: 83,416,163 (GRCm39) I818V possibly damaging Het
Zdhhc18 A G 4: 133,341,165 (GRCm39) L236P probably damaging Het
Zfp266 T C 9: 20,411,610 (GRCm39) D189G probably benign Het
Zfp474 A T 18: 52,772,229 (GRCm39) D294V probably damaging Het
Zfp568 T C 7: 29,722,758 (GRCm39) F568L probably damaging Het
Zfp93 A G 7: 23,975,479 (GRCm39) K488R probably benign Het
Other mutations in Srcap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Srcap APN 7 127,141,885 (GRCm39) splice site probably benign
IGL00475:Srcap APN 7 127,152,093 (GRCm39) missense possibly damaging 0.92
IGL01064:Srcap APN 7 127,159,064 (GRCm39) unclassified probably benign
IGL01129:Srcap APN 7 127,120,823 (GRCm39) missense probably damaging 1.00
IGL01670:Srcap APN 7 127,127,604 (GRCm39) missense probably damaging 1.00
IGL01861:Srcap APN 7 127,124,457 (GRCm39) splice site probably benign
IGL02237:Srcap APN 7 127,133,864 (GRCm39) splice site probably benign
IGL02665:Srcap APN 7 127,140,075 (GRCm39) missense probably damaging 1.00
IGL02688:Srcap APN 7 127,141,625 (GRCm39) missense probably benign 0.04
IGL02744:Srcap APN 7 127,133,838 (GRCm39) missense probably damaging 1.00
IGL02810:Srcap APN 7 127,120,835 (GRCm39) critical splice donor site probably null
IGL03184:Srcap APN 7 127,129,674 (GRCm39) unclassified probably benign
IGL03309:Srcap APN 7 127,129,965 (GRCm39) missense probably damaging 0.99
PIT4453001:Srcap UTSW 7 127,148,492 (GRCm39) missense possibly damaging 0.52
R1340:Srcap UTSW 7 127,159,910 (GRCm39) intron probably benign
R1401:Srcap UTSW 7 127,159,124 (GRCm39) unclassified probably benign
R1455:Srcap UTSW 7 127,129,822 (GRCm39) missense probably damaging 0.99
R1470:Srcap UTSW 7 127,158,899 (GRCm39) unclassified probably benign
R1470:Srcap UTSW 7 127,158,899 (GRCm39) unclassified probably benign
R1761:Srcap UTSW 7 127,134,017 (GRCm39) missense probably damaging 1.00
R1911:Srcap UTSW 7 127,133,994 (GRCm39) missense probably damaging 0.99
R2483:Srcap UTSW 7 127,141,319 (GRCm39) missense probably damaging 0.99
R2892:Srcap UTSW 7 127,138,237 (GRCm39) missense probably damaging 0.99
R2893:Srcap UTSW 7 127,138,237 (GRCm39) missense probably damaging 0.99
R3623:Srcap UTSW 7 127,141,319 (GRCm39) missense probably damaging 0.99
R3976:Srcap UTSW 7 127,148,411 (GRCm39) missense probably benign 0.18
R4001:Srcap UTSW 7 127,131,339 (GRCm39) missense probably damaging 1.00
R4015:Srcap UTSW 7 127,124,595 (GRCm39) missense probably benign 0.27
R4581:Srcap UTSW 7 127,157,482 (GRCm39) unclassified probably benign
R4643:Srcap UTSW 7 127,140,948 (GRCm39) missense probably damaging 1.00
R4644:Srcap UTSW 7 127,151,770 (GRCm39) missense probably damaging 1.00
R4690:Srcap UTSW 7 127,137,186 (GRCm39) missense probably damaging 1.00
R4693:Srcap UTSW 7 127,137,716 (GRCm39) missense probably damaging 1.00
R4719:Srcap UTSW 7 127,140,731 (GRCm39) missense probably benign 0.13
R4728:Srcap UTSW 7 127,140,096 (GRCm39) critical splice donor site probably null
R4740:Srcap UTSW 7 127,148,471 (GRCm39) missense probably damaging 1.00
R4752:Srcap UTSW 7 127,158,172 (GRCm39) unclassified probably benign
R4834:Srcap UTSW 7 127,156,782 (GRCm39) critical splice donor site probably null
R4837:Srcap UTSW 7 127,158,134 (GRCm39) unclassified probably benign
R4884:Srcap UTSW 7 127,121,189 (GRCm39) missense probably damaging 1.00
R4889:Srcap UTSW 7 127,137,719 (GRCm39) missense possibly damaging 0.94
R5088:Srcap UTSW 7 127,140,833 (GRCm39) missense probably benign 0.02
R5102:Srcap UTSW 7 127,129,795 (GRCm39) missense probably damaging 1.00
R5358:Srcap UTSW 7 127,139,492 (GRCm39) missense probably damaging 1.00
R5372:Srcap UTSW 7 127,156,785 (GRCm39) splice site probably null
R5397:Srcap UTSW 7 127,152,468 (GRCm39) critical splice donor site probably null
R5481:Srcap UTSW 7 127,131,369 (GRCm39) missense probably damaging 1.00
R5566:Srcap UTSW 7 127,124,475 (GRCm39) missense probably damaging 0.99
R5584:Srcap UTSW 7 127,127,651 (GRCm39) missense probably damaging 1.00
R5693:Srcap UTSW 7 127,118,988 (GRCm39) missense probably damaging 1.00
R5769:Srcap UTSW 7 127,158,994 (GRCm39) unclassified probably benign
R5805:Srcap UTSW 7 127,141,211 (GRCm39) missense possibly damaging 0.87
R5806:Srcap UTSW 7 127,158,335 (GRCm39) unclassified probably benign
R5921:Srcap UTSW 7 127,158,005 (GRCm39) unclassified probably benign
R5942:Srcap UTSW 7 127,137,180 (GRCm39) missense probably damaging 1.00
R6014:Srcap UTSW 7 127,137,922 (GRCm39) missense probably benign 0.01
R6057:Srcap UTSW 7 127,140,528 (GRCm39) missense probably damaging 0.99
R6113:Srcap UTSW 7 127,159,453 (GRCm39) unclassified probably benign
R6150:Srcap UTSW 7 127,134,000 (GRCm39) missense probably damaging 1.00
R6212:Srcap UTSW 7 127,148,861 (GRCm39) missense probably damaging 1.00
R6299:Srcap UTSW 7 127,129,626 (GRCm39) unclassified probably benign
R6437:Srcap UTSW 7 127,127,722 (GRCm39) splice site probably null
R6492:Srcap UTSW 7 127,121,317 (GRCm39) nonsense probably null
R6537:Srcap UTSW 7 127,141,392 (GRCm39) missense probably damaging 0.97
R6659:Srcap UTSW 7 127,141,563 (GRCm39) missense probably damaging 1.00
R6713:Srcap UTSW 7 127,134,089 (GRCm39) missense probably benign 0.28
R6717:Srcap UTSW 7 127,157,482 (GRCm39) unclassified probably benign
R6941:Srcap UTSW 7 127,141,769 (GRCm39) missense probably damaging 1.00
R7068:Srcap UTSW 7 127,141,115 (GRCm39) missense probably benign 0.00
R7097:Srcap UTSW 7 127,138,213 (GRCm39) missense probably damaging 1.00
R7394:Srcap UTSW 7 127,134,000 (GRCm39) missense probably damaging 1.00
R7426:Srcap UTSW 7 127,137,689 (GRCm39) missense possibly damaging 0.90
R7434:Srcap UTSW 7 127,159,414 (GRCm39) missense unknown
R7559:Srcap UTSW 7 127,129,722 (GRCm39) missense unknown
R7638:Srcap UTSW 7 127,137,920 (GRCm39) missense probably benign 0.39
R7677:Srcap UTSW 7 127,158,980 (GRCm39) missense unknown
R7715:Srcap UTSW 7 127,148,460 (GRCm39) missense probably damaging 0.99
R7757:Srcap UTSW 7 127,129,966 (GRCm39) missense probably damaging 0.99
R7811:Srcap UTSW 7 127,141,221 (GRCm39) missense probably damaging 0.97
R7821:Srcap UTSW 7 127,129,499 (GRCm39) unclassified probably benign
R7869:Srcap UTSW 7 127,138,366 (GRCm39) missense possibly damaging 0.92
R7870:Srcap UTSW 7 127,159,730 (GRCm39) missense unknown
R7941:Srcap UTSW 7 127,157,462 (GRCm39) unclassified probably benign
R7994:Srcap UTSW 7 127,140,930 (GRCm39) missense probably benign 0.00
R8035:Srcap UTSW 7 127,141,784 (GRCm39) missense probably benign 0.05
R8066:Srcap UTSW 7 127,139,484 (GRCm39) missense possibly damaging 0.74
R8066:Srcap UTSW 7 127,120,804 (GRCm39) missense probably damaging 1.00
R8168:Srcap UTSW 7 127,141,695 (GRCm39) missense probably damaging 1.00
R8288:Srcap UTSW 7 127,130,528 (GRCm39) missense probably damaging 1.00
R8307:Srcap UTSW 7 127,124,541 (GRCm39) missense probably damaging 1.00
R8308:Srcap UTSW 7 127,152,353 (GRCm39) missense possibly damaging 0.82
R8309:Srcap UTSW 7 127,148,529 (GRCm39) missense probably damaging 0.98
R8311:Srcap UTSW 7 127,156,969 (GRCm39) missense probably damaging 0.99
R8321:Srcap UTSW 7 127,140,068 (GRCm39) missense probably damaging 1.00
R8365:Srcap UTSW 7 127,148,869 (GRCm39) missense probably damaging 1.00
R8424:Srcap UTSW 7 127,141,560 (GRCm39) missense probably benign 0.00
R8815:Srcap UTSW 7 127,158,037 (GRCm39) missense unknown
R8817:Srcap UTSW 7 127,152,395 (GRCm39) missense probably benign 0.23
R8924:Srcap UTSW 7 127,158,204 (GRCm39) missense unknown
R8933:Srcap UTSW 7 127,151,566 (GRCm39) missense probably damaging 1.00
R8961:Srcap UTSW 7 127,141,101 (GRCm39) missense probably damaging 1.00
R9000:Srcap UTSW 7 127,130,943 (GRCm39) missense possibly damaging 0.91
R9098:Srcap UTSW 7 127,151,816 (GRCm39) missense probably damaging 0.99
R9124:Srcap UTSW 7 127,159,874 (GRCm39) missense unknown
R9163:Srcap UTSW 7 127,121,162 (GRCm39) missense unknown
R9332:Srcap UTSW 7 127,158,812 (GRCm39) missense unknown
R9389:Srcap UTSW 7 127,141,455 (GRCm39) missense probably damaging 1.00
R9464:Srcap UTSW 7 127,137,273 (GRCm39) missense possibly damaging 0.95
R9467:Srcap UTSW 7 127,139,531 (GRCm39) missense probably damaging 0.98
R9554:Srcap UTSW 7 127,151,577 (GRCm39) missense probably damaging 1.00
R9596:Srcap UTSW 7 127,131,036 (GRCm39) missense probably damaging 1.00
R9597:Srcap UTSW 7 127,121,219 (GRCm39) missense possibly damaging 0.91
X0025:Srcap UTSW 7 127,159,277 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AACCCTGTCACTGAAGCCAG -3'
(R):5'- CCACAGGATAAACTGAATTCCTTC -3'

Sequencing Primer
(F):5'- TGAAGCCAGCCCCACCTG -3'
(R):5'- CAGGATAAACTGAATTCCTTCATGTC -3'
Posted On 2020-07-13