Incidental Mutation 'R8194:Muc2'
ID 635348
Institutional Source Beutler Lab
Gene Symbol Muc2
Ensembl Gene ENSMUSG00000025515
Gene Name mucin 2
Synonyms 2010015E03Rik
MMRRC Submission 067617-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.100) question?
Stock # R8194 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 141276583-141308428 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 141290801 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 29 (C29F)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167366] [ENSMUST00000185823]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000167366
SMART Domains Protein: ENSMUSP00000128250
Gene: ENSMUSG00000025515

DomainStartEndE-ValueType
Pfam:VWD 3 72 2.3e-14 PFAM
C8 107 181 1.82e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185823
SMART Domains Protein: ENSMUSP00000140855
Gene: ENSMUSG00000025515

DomainStartEndE-ValueType
Pfam:VWD 3 73 5.6e-14 PFAM
C8 108 182 1.4e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187789
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4a T A 12: 71,106,889 (GRCm39) Y320* probably null Het
Ash1l T A 3: 88,960,062 (GRCm39) C2265S probably damaging Het
Atg4b T A 1: 93,713,694 (GRCm39) C55* probably null Het
Cacna1s A T 1: 136,005,430 (GRCm39) N405I probably benign Het
Capn11 A T 17: 45,944,325 (GRCm39) D526E probably damaging Het
Ccdc188 A G 16: 18,036,244 (GRCm39) R71G probably benign Het
Ccser2 G A 14: 36,618,220 (GRCm39) R772W probably damaging Het
Cenpf T A 1: 189,414,600 (GRCm39) E172D probably benign Het
Cep85 T C 4: 133,861,400 (GRCm39) M627V probably null Het
Chd1 G A 17: 17,594,737 (GRCm39) probably benign Het
Cnst A G 1: 179,437,759 (GRCm39) H441R probably benign Het
Cyp2d11 G T 15: 82,274,638 (GRCm39) T313N probably damaging Het
Cyp2g1 A G 7: 26,514,159 (GRCm39) N255S possibly damaging Het
Dnah5 A G 15: 28,453,414 (GRCm39) D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 75,874,624 (GRCm39) probably benign Het
Fcnb C T 2: 27,968,330 (GRCm39) S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,217,364 (GRCm39) probably null Het
Lama4 A G 10: 38,954,716 (GRCm39) S1090G probably damaging Het
Malrd1 A G 2: 15,929,931 (GRCm39) D1479G unknown Het
Man2a2 T C 7: 80,010,766 (GRCm39) K742E probably benign Het
Mapk8 A T 14: 33,104,241 (GRCm39) S392T probably benign Het
Mark3 T C 12: 111,559,117 (GRCm39) I53T probably damaging Het
Mcmdc2 A G 1: 9,986,867 (GRCm39) I219V probably benign Het
Mlycd A T 8: 120,134,332 (GRCm39) E278V probably benign Het
Mup20 T C 4: 61,971,721 (GRCm39) I77V probably benign Het
Myh3 A G 11: 66,982,828 (GRCm39) E849G probably damaging Het
Nedd4 A G 9: 72,593,389 (GRCm39) N154S probably damaging Het
Odad4 G A 11: 100,454,502 (GRCm39) G429E probably benign Het
Or1e1f A T 11: 73,856,240 (GRCm39) I269F probably benign Het
Pcdh7 A T 5: 57,877,678 (GRCm39) N411I probably damaging Het
Plekhm1 A G 11: 103,285,886 (GRCm39) I183T possibly damaging Het
Prkar2a G A 9: 108,569,710 (GRCm39) V19M probably damaging Het
Prss35 T G 9: 86,637,666 (GRCm39) N145K possibly damaging Het
Ranbp2 T A 10: 58,291,747 (GRCm39) D251E possibly damaging Het
Rnf169 C A 7: 99,575,651 (GRCm39) V315F probably damaging Het
Slc32a1 T C 2: 158,455,761 (GRCm39) Y139H probably damaging Het
Slc5a2 T C 7: 127,870,328 (GRCm39) V522A probably benign Het
Slc6a6 A T 6: 91,717,952 (GRCm39) Q297L probably damaging Het
Sos2 A C 12: 69,645,598 (GRCm39) Y914D probably damaging Het
Spata1 G T 3: 146,195,614 (GRCm39) T32N possibly damaging Het
Srcap C T 7: 127,138,369 (GRCm39) R1180C probably damaging Het
St14 A T 9: 31,042,921 (GRCm39) M1K probably null Het
Tcaf1 T C 6: 42,652,236 (GRCm39) T749A probably benign Het
Tcp1 T C 17: 13,141,621 (GRCm39) probably null Het
Tle6 A G 10: 81,426,888 (GRCm39) V576A probably damaging Het
Usp17lc T A 7: 103,067,407 (GRCm39) M234K probably benign Het
Washc4 A G 10: 83,416,163 (GRCm39) I818V possibly damaging Het
Zdhhc18 A G 4: 133,341,165 (GRCm39) L236P probably damaging Het
Zfp266 T C 9: 20,411,610 (GRCm39) D189G probably benign Het
Zfp474 A T 18: 52,772,229 (GRCm39) D294V probably damaging Het
Zfp568 T C 7: 29,722,758 (GRCm39) F568L probably damaging Het
Zfp93 A G 7: 23,975,479 (GRCm39) K488R probably benign Het
Other mutations in Muc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
Eeyore APN 7 141,693,356 (GRCm38) missense probably benign 0.35
kenny APN 7 0 () nonsense
Winnie APN 7 141,286,029 (GRCm39) missense probably damaging 1.00
IGL01303:Muc2 APN 7 141,306,132 (GRCm39) missense probably benign
IGL01482:Muc2 APN 7 141,307,797 (GRCm39) missense probably damaging 0.96
IGL01875:Muc2 APN 7 141,306,477 (GRCm39) missense probably damaging 0.99
IGL02088:Muc2 APN 7 141,305,241 (GRCm39) missense probably damaging 1.00
IGL02415:Muc2 APN 7 141,305,609 (GRCm39) nonsense probably null
IGL02548:Muc2 APN 7 141,305,594 (GRCm39) missense probably damaging 1.00
IGL02836:Muc2 APN 7 141,300,450 (GRCm39) unclassified probably benign
IGL03196:Muc2 APN 7 141,301,367 (GRCm39) missense probably damaging 0.97
Muskatenwein UTSW 7 141,307,176 (GRCm39) missense unknown
nomoco UTSW 7 141,307,456 (GRCm39) missense probably damaging 1.00
Schlendrian UTSW 7 141,281,925 (GRCm39) missense probably damaging 1.00
Seco UTSW 7 141,284,976 (GRCm39) missense probably damaging 1.00
BB001:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
BB011:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
E0370:Muc2 UTSW 7 141,282,598 (GRCm39) missense probably damaging 1.00
R0127:Muc2 UTSW 7 141,302,691 (GRCm39) missense probably benign 0.00
R0179:Muc2 UTSW 7 141,302,708 (GRCm39) missense probably damaging 1.00
R0201:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R0299:Muc2 UTSW 7 141,306,466 (GRCm39) missense probably damaging 1.00
R0547:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R0699:Muc2 UTSW 7 141,306,037 (GRCm39) missense probably damaging 1.00
R0900:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R1348:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R1466:Muc2 UTSW 7 141,302,711 (GRCm39) missense probably damaging 1.00
R1466:Muc2 UTSW 7 141,302,711 (GRCm39) missense probably damaging 1.00
R1625:Muc2 UTSW 7 141,283,405 (GRCm39) missense probably damaging 1.00
R2010:Muc2 UTSW 7 141,287,444 (GRCm39) missense probably damaging 0.99
R2149:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R2163:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R3008:Muc2 UTSW 7 141,281,347 (GRCm39) missense possibly damaging 0.93
R3110:Muc2 UTSW 7 141,299,225 (GRCm39) unclassified probably benign
R3112:Muc2 UTSW 7 141,299,225 (GRCm39) unclassified probably benign
R3424:Muc2 UTSW 7 141,279,595 (GRCm39) missense probably damaging 0.99
R3786:Muc2 UTSW 7 141,283,590 (GRCm39) missense probably benign 0.01
R3854:Muc2 UTSW 7 141,308,081 (GRCm39) missense probably damaging 1.00
R3964:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3965:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3966:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3973:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R3974:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R3976:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R4327:Muc2 UTSW 7 141,281,577 (GRCm39) missense probably damaging 0.96
R4694:Muc2 UTSW 7 141,306,082 (GRCm39) missense probably damaging 1.00
R4764:Muc2 UTSW 7 141,299,345 (GRCm39) missense possibly damaging 0.88
R4769:Muc2 UTSW 7 141,286,260 (GRCm39) critical splice donor site probably null
R4798:Muc2 UTSW 7 141,307,877 (GRCm39) missense probably benign 0.01
R4900:Muc2 UTSW 7 141,303,280 (GRCm39) missense probably benign 0.32
R5383:Muc2 UTSW 7 141,307,456 (GRCm39) missense probably damaging 1.00
R5489:Muc2 UTSW 7 141,305,169 (GRCm39) missense probably benign 0.00
R5615:Muc2 UTSW 7 141,277,446 (GRCm39) missense probably damaging 1.00
R5856:Muc2 UTSW 7 141,299,381 (GRCm39) unclassified probably benign
R5919:Muc2 UTSW 7 141,281,171 (GRCm39) missense probably damaging 0.97
R5953:Muc2 UTSW 7 141,287,951 (GRCm39) missense probably damaging 0.96
R5979:Muc2 UTSW 7 141,305,143 (GRCm39) missense probably damaging 0.99
R5979:Muc2 UTSW 7 141,283,493 (GRCm39) splice site probably null
R6175:Muc2 UTSW 7 141,282,875 (GRCm39) missense probably damaging 1.00
R6213:Muc2 UTSW 7 141,305,151 (GRCm39) missense probably damaging 1.00
R6281:Muc2 UTSW 7 141,306,140 (GRCm39) missense probably damaging 1.00
R6321:Muc2 UTSW 7 141,287,397 (GRCm39) missense probably benign 0.28
R6390:Muc2 UTSW 7 141,305,883 (GRCm39) missense probably damaging 0.97
R6485:Muc2 UTSW 7 141,300,473 (GRCm39) unclassified probably benign
R6582:Muc2 UTSW 7 141,282,941 (GRCm39) missense probably benign 0.00
R6683:Muc2 UTSW 7 141,305,214 (GRCm39) missense probably benign 0.38
R6896:Muc2 UTSW 7 141,306,432 (GRCm39) missense possibly damaging 0.48
R6906:Muc2 UTSW 7 141,284,976 (GRCm39) missense probably damaging 1.00
R6924:Muc2 UTSW 7 141,284,077 (GRCm39) missense possibly damaging 0.87
R7040:Muc2 UTSW 7 141,305,194 (GRCm39) missense unknown
R7222:Muc2 UTSW 7 141,290,758 (GRCm39) missense
R7251:Muc2 UTSW 7 141,278,965 (GRCm39) missense possibly damaging 0.91
R7282:Muc2 UTSW 7 141,306,481 (GRCm39) missense
R7315:Muc2 UTSW 7 141,276,645 (GRCm39) missense probably damaging 0.99
R7421:Muc2 UTSW 7 141,301,863 (GRCm39) missense
R7556:Muc2 UTSW 7 141,307,439 (GRCm39) missense
R7651:Muc2 UTSW 7 141,290,750 (GRCm39) missense
R7710:Muc2 UTSW 7 141,287,452 (GRCm39) missense possibly damaging 0.92
R7776:Muc2 UTSW 7 141,290,942 (GRCm39) missense
R7813:Muc2 UTSW 7 141,282,543 (GRCm39) splice site probably null
R7843:Muc2 UTSW 7 141,281,662 (GRCm39) missense probably benign 0.03
R7869:Muc2 UTSW 7 141,303,471 (GRCm39) missense
R7924:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
R7993:Muc2 UTSW 7 141,308,173 (GRCm39) missense
R8053:Muc2 UTSW 7 141,284,575 (GRCm39) missense probably benign 0.01
R8068:Muc2 UTSW 7 141,298,422 (GRCm39) missense
R8099:Muc2 UTSW 7 141,299,175 (GRCm39) splice site probably null
R8192:Muc2 UTSW 7 141,305,215 (GRCm39) missense
R8545:Muc2 UTSW 7 141,306,130 (GRCm39) missense unknown
R8701:Muc2 UTSW 7 141,281,850 (GRCm39) missense probably damaging 1.00
R8883:Muc2 UTSW 7 141,287,469 (GRCm39) missense probably damaging 0.98
R8894:Muc2 UTSW 7 141,280,758 (GRCm39) missense probably damaging 1.00
R8905:Muc2 UTSW 7 141,279,643 (GRCm39) missense probably benign 0.00
R9024:Muc2 UTSW 7 141,287,936 (GRCm39) missense probably damaging 0.98
R9032:Muc2 UTSW 7 141,287,058 (GRCm39) missense probably damaging 1.00
R9085:Muc2 UTSW 7 141,287,058 (GRCm39) missense probably damaging 1.00
R9091:Muc2 UTSW 7 141,290,816 (GRCm39) missense
R9104:Muc2 UTSW 7 141,286,224 (GRCm39) missense probably damaging 1.00
R9114:Muc2 UTSW 7 141,287,983 (GRCm39) nonsense probably null
R9270:Muc2 UTSW 7 141,290,816 (GRCm39) missense
R9297:Muc2 UTSW 7 141,302,759 (GRCm39) missense
R9325:Muc2 UTSW 7 141,298,559 (GRCm39) missense
R9354:Muc2 UTSW 7 141,307,157 (GRCm39) missense
R9386:Muc2 UTSW 7 141,279,389 (GRCm39) missense probably damaging 1.00
R9529:Muc2 UTSW 7 141,287,453 (GRCm39) missense possibly damaging 0.55
R9550:Muc2 UTSW 7 141,308,242 (GRCm39) missense probably damaging 1.00
R9583:Muc2 UTSW 7 141,300,559 (GRCm39) missense
R9607:Muc2 UTSW 7 141,305,190 (GRCm39) missense
R9646:Muc2 UTSW 7 141,276,643 (GRCm39) missense probably benign
R9651:Muc2 UTSW 7 141,288,014 (GRCm39) missense probably damaging 0.99
R9774:Muc2 UTSW 7 141,285,811 (GRCm39) missense probably benign
R9784:Muc2 UTSW 7 141,280,785 (GRCm39) nonsense probably null
Z1176:Muc2 UTSW 7 141,300,451 (GRCm39) missense
Z1177:Muc2 UTSW 7 141,298,531 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TGGGTTAATACAACTTGGTCATTGG -3'
(R):5'- TGGATAGCAACAGTTGACTCG -3'

Sequencing Primer
(F):5'- ATACAACTTGGTCATTGGTGATG -3'
(R):5'- GGATAGCAACAGTTGACTCGTATCTC -3'
Posted On 2020-07-13