Incidental Mutation 'R8194:Mlycd'
ID635349
Institutional Source Beutler Lab
Gene Symbol Mlycd
Ensembl Gene ENSMUSG00000074064
Gene Namemalonyl-CoA decarboxylase
SynonymsMcd
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R8194 (G1)
Quality Score219.009
Status Validated
Chromosome8
Chromosomal Location119394878-119411102 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119407593 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 278 (E278V)
Ref Sequence ENSEMBL: ENSMUSP00000095970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098367]
Predicted Effect probably benign
Transcript: ENSMUST00000098367
AA Change: E278V

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000095970
Gene: ENSMUSG00000074064
AA Change: E278V

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
Pfam:MCD 92 456 1.3e-120 PFAM
Meta Mutation Damage Score 0.3607 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene catalyzes the breakdown of malonyl-CoA to acetyl-CoA and carbon dioxide. Malonyl-CoA is an intermediate in fatty acid biosynthesis, and also inhibits the transport of fatty acyl CoAs into mitochondria. Consequently, the encoded protein acts to increase the rate of fatty acid oxidation. It is found in mitochondria, peroxisomes, and the cytoplasm. Mutations in this gene result in malonyl-CoA decarboyxlase deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit altered cardiac metabolism following ischemia and improved recovery. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230046K03Rik A G 10: 83,580,299 I818V possibly damaging Het
Arid4a T A 12: 71,060,115 Y320* probably null Het
Ash1l T A 3: 89,052,755 C2265S probably damaging Het
Atg4b T A 1: 93,785,972 C55* probably null Het
Cacna1s A T 1: 136,077,692 N405I probably benign Het
Capn11 A T 17: 45,633,399 D526E probably damaging Het
Ccdc188 A G 16: 18,218,380 R71G probably benign Het
Ccser2 G A 14: 36,896,263 R772W probably damaging Het
Cenpf T A 1: 189,682,403 E172D probably benign Het
Cep85 T C 4: 134,134,089 M627V probably null Het
Chd1 G A 17: 17,374,475 probably benign Het
Cnst A G 1: 179,610,194 H441R probably benign Het
Cyp2d11 G T 15: 82,390,437 T313N probably damaging Het
Cyp2g1 A G 7: 26,814,734 N255S possibly damaging Het
Dnah5 A G 15: 28,453,268 D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,327,352 probably null Het
Lama4 A G 10: 39,078,720 S1090G probably damaging Het
Malrd1 A G 2: 15,925,120 D1479G unknown Het
Man2a2 T C 7: 80,361,018 K742E probably benign Het
Mapk8 A T 14: 33,382,284 S392T probably benign Het
Mark3 T C 12: 111,592,683 I53T probably damaging Het
Mcmdc2 A G 1: 9,916,642 I219V probably benign Het
Muc2 G T 7: 141,704,252 C29F Het
Mup20 T C 4: 62,053,484 I77V probably benign Het
Myh3 A G 11: 67,092,002 E849G probably damaging Het
Nedd4 A G 9: 72,686,107 N154S probably damaging Het
Olfr397 A T 11: 73,965,414 I269F probably benign Het
Pcdh7 A T 5: 57,720,336 N411I probably damaging Het
Plekhm1 A G 11: 103,395,060 I183T possibly damaging Het
Prkar2a G A 9: 108,692,511 V19M probably damaging Het
Prss35 T G 9: 86,755,613 N145K possibly damaging Het
Ranbp2 T A 10: 58,455,925 D251E possibly damaging Het
Rnf169 C A 7: 99,926,444 V315F probably damaging Het
Slc32a1 T C 2: 158,613,841 Y139H probably damaging Het
Slc5a2 T C 7: 128,271,156 V522A probably benign Het
Slc6a6 A T 6: 91,740,971 Q297L probably damaging Het
Sos2 A C 12: 69,598,824 Y914D probably damaging Het
Spata1 G T 3: 146,489,859 T32N possibly damaging Het
Srcap C T 7: 127,539,197 R1180C probably damaging Het
St14 A T 9: 31,131,625 M1K probably null Het
Tcaf1 T C 6: 42,675,302 T749A probably benign Het
Tcp1 T C 17: 12,922,734 probably null Het
Tle6 A G 10: 81,591,054 V576A probably damaging Het
Ttc25 G A 11: 100,563,676 G429E probably benign Het
Usp17lc T A 7: 103,418,200 M234K probably benign Het
Zdhhc18 A G 4: 133,613,854 L236P probably damaging Het
Zfp266 T C 9: 20,500,314 D189G probably benign Het
Zfp474 A T 18: 52,639,157 D294V probably damaging Het
Zfp568 T C 7: 30,023,333 F568L probably damaging Het
Zfp93 A G 7: 24,276,054 K488R probably benign Het
Other mutations in Mlycd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02481:Mlycd APN 8 119410334 missense probably damaging 1.00
IGL02976:Mlycd APN 8 119401485 missense possibly damaging 0.70
PIT4142001:Mlycd UTSW 8 119410460 missense probably damaging 1.00
R0026:Mlycd UTSW 8 119410435 missense probably benign
R0164:Mlycd UTSW 8 119407641 missense probably damaging 1.00
R0164:Mlycd UTSW 8 119407641 missense probably damaging 1.00
R1531:Mlycd UTSW 8 119401519 nonsense probably null
R2508:Mlycd UTSW 8 119407707 critical splice donor site probably null
R4449:Mlycd UTSW 8 119410405 missense probably damaging 1.00
R5061:Mlycd UTSW 8 119410304 missense probably damaging 1.00
R5781:Mlycd UTSW 8 119410280 missense probably damaging 1.00
R7135:Mlycd UTSW 8 119402477 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGATGGCCTGAACCTGAG -3'
(R):5'- GTCTGCATCCCTGTGAGACATC -3'

Sequencing Primer
(F):5'- TGGCCTGAACCTGAGCAACC -3'
(R):5'- TCCCTGTGAGACATCCCAGAGAG -3'
Posted On2020-07-13