Incidental Mutation 'R8194:Mlycd'
ID 635349
Institutional Source Beutler Lab
Gene Symbol Mlycd
Ensembl Gene ENSMUSG00000074064
Gene Name malonyl-CoA decarboxylase
Synonyms Mcd
MMRRC Submission 067617-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.146) question?
Stock # R8194 (G1)
Quality Score 219.009
Status Validated
Chromosome 8
Chromosomal Location 120121617-120137841 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 120134332 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 278 (E278V)
Ref Sequence ENSEMBL: ENSMUSP00000095970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098367]
AlphaFold Q99J39
Predicted Effect probably benign
Transcript: ENSMUST00000098367
AA Change: E278V

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000095970
Gene: ENSMUSG00000074064
AA Change: E278V

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
Pfam:MCD 92 456 1.3e-120 PFAM
Meta Mutation Damage Score 0.3607 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene catalyzes the breakdown of malonyl-CoA to acetyl-CoA and carbon dioxide. Malonyl-CoA is an intermediate in fatty acid biosynthesis, and also inhibits the transport of fatty acyl CoAs into mitochondria. Consequently, the encoded protein acts to increase the rate of fatty acid oxidation. It is found in mitochondria, peroxisomes, and the cytoplasm. Mutations in this gene result in malonyl-CoA decarboyxlase deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit altered cardiac metabolism following ischemia and improved recovery. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4a T A 12: 71,106,889 (GRCm39) Y320* probably null Het
Ash1l T A 3: 88,960,062 (GRCm39) C2265S probably damaging Het
Atg4b T A 1: 93,713,694 (GRCm39) C55* probably null Het
Cacna1s A T 1: 136,005,430 (GRCm39) N405I probably benign Het
Capn11 A T 17: 45,944,325 (GRCm39) D526E probably damaging Het
Ccdc188 A G 16: 18,036,244 (GRCm39) R71G probably benign Het
Ccser2 G A 14: 36,618,220 (GRCm39) R772W probably damaging Het
Cenpf T A 1: 189,414,600 (GRCm39) E172D probably benign Het
Cep85 T C 4: 133,861,400 (GRCm39) M627V probably null Het
Chd1 G A 17: 17,594,737 (GRCm39) probably benign Het
Cnst A G 1: 179,437,759 (GRCm39) H441R probably benign Het
Cyp2d11 G T 15: 82,274,638 (GRCm39) T313N probably damaging Het
Cyp2g1 A G 7: 26,514,159 (GRCm39) N255S possibly damaging Het
Dnah5 A G 15: 28,453,414 (GRCm39) D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 75,874,624 (GRCm39) probably benign Het
Fcnb C T 2: 27,968,330 (GRCm39) S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,217,364 (GRCm39) probably null Het
Lama4 A G 10: 38,954,716 (GRCm39) S1090G probably damaging Het
Malrd1 A G 2: 15,929,931 (GRCm39) D1479G unknown Het
Man2a2 T C 7: 80,010,766 (GRCm39) K742E probably benign Het
Mapk8 A T 14: 33,104,241 (GRCm39) S392T probably benign Het
Mark3 T C 12: 111,559,117 (GRCm39) I53T probably damaging Het
Mcmdc2 A G 1: 9,986,867 (GRCm39) I219V probably benign Het
Muc2 G T 7: 141,290,801 (GRCm39) C29F Het
Mup20 T C 4: 61,971,721 (GRCm39) I77V probably benign Het
Myh3 A G 11: 66,982,828 (GRCm39) E849G probably damaging Het
Nedd4 A G 9: 72,593,389 (GRCm39) N154S probably damaging Het
Odad4 G A 11: 100,454,502 (GRCm39) G429E probably benign Het
Or1e1f A T 11: 73,856,240 (GRCm39) I269F probably benign Het
Pcdh7 A T 5: 57,877,678 (GRCm39) N411I probably damaging Het
Plekhm1 A G 11: 103,285,886 (GRCm39) I183T possibly damaging Het
Prkar2a G A 9: 108,569,710 (GRCm39) V19M probably damaging Het
Prss35 T G 9: 86,637,666 (GRCm39) N145K possibly damaging Het
Ranbp2 T A 10: 58,291,747 (GRCm39) D251E possibly damaging Het
Rnf169 C A 7: 99,575,651 (GRCm39) V315F probably damaging Het
Slc32a1 T C 2: 158,455,761 (GRCm39) Y139H probably damaging Het
Slc5a2 T C 7: 127,870,328 (GRCm39) V522A probably benign Het
Slc6a6 A T 6: 91,717,952 (GRCm39) Q297L probably damaging Het
Sos2 A C 12: 69,645,598 (GRCm39) Y914D probably damaging Het
Spata1 G T 3: 146,195,614 (GRCm39) T32N possibly damaging Het
Srcap C T 7: 127,138,369 (GRCm39) R1180C probably damaging Het
St14 A T 9: 31,042,921 (GRCm39) M1K probably null Het
Tcaf1 T C 6: 42,652,236 (GRCm39) T749A probably benign Het
Tcp1 T C 17: 13,141,621 (GRCm39) probably null Het
Tle6 A G 10: 81,426,888 (GRCm39) V576A probably damaging Het
Usp17lc T A 7: 103,067,407 (GRCm39) M234K probably benign Het
Washc4 A G 10: 83,416,163 (GRCm39) I818V possibly damaging Het
Zdhhc18 A G 4: 133,341,165 (GRCm39) L236P probably damaging Het
Zfp266 T C 9: 20,411,610 (GRCm39) D189G probably benign Het
Zfp474 A T 18: 52,772,229 (GRCm39) D294V probably damaging Het
Zfp568 T C 7: 29,722,758 (GRCm39) F568L probably damaging Het
Zfp93 A G 7: 23,975,479 (GRCm39) K488R probably benign Het
Other mutations in Mlycd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02481:Mlycd APN 8 120,137,073 (GRCm39) missense probably damaging 1.00
IGL02976:Mlycd APN 8 120,128,224 (GRCm39) missense possibly damaging 0.70
PIT4142001:Mlycd UTSW 8 120,137,199 (GRCm39) missense probably damaging 1.00
R0026:Mlycd UTSW 8 120,137,174 (GRCm39) missense probably benign
R0164:Mlycd UTSW 8 120,134,380 (GRCm39) missense probably damaging 1.00
R0164:Mlycd UTSW 8 120,134,380 (GRCm39) missense probably damaging 1.00
R1531:Mlycd UTSW 8 120,128,258 (GRCm39) nonsense probably null
R2508:Mlycd UTSW 8 120,134,446 (GRCm39) critical splice donor site probably null
R4449:Mlycd UTSW 8 120,137,144 (GRCm39) missense probably damaging 1.00
R5061:Mlycd UTSW 8 120,137,043 (GRCm39) missense probably damaging 1.00
R5781:Mlycd UTSW 8 120,137,019 (GRCm39) missense probably damaging 1.00
R7135:Mlycd UTSW 8 120,129,216 (GRCm39) missense probably damaging 1.00
R9778:Mlycd UTSW 8 120,129,325 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGATGGCCTGAACCTGAG -3'
(R):5'- GTCTGCATCCCTGTGAGACATC -3'

Sequencing Primer
(F):5'- TGGCCTGAACCTGAGCAACC -3'
(R):5'- TCCCTGTGAGACATCCCAGAGAG -3'
Posted On 2020-07-13