Incidental Mutation 'R8194:Zfp266'
ID 635350
Institutional Source Beutler Lab
Gene Symbol Zfp266
Ensembl Gene ENSMUSG00000060510
Gene Name zinc finger protein 266
Synonyms 5330440G10Rik, 5730601F06Rik
MMRRC Submission 067617-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R8194 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 20406364-20432713 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20411610 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 189 (D189G)
Ref Sequence ENSEMBL: ENSMUSP00000066012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068296] [ENSMUST00000174462]
AlphaFold E9Q2S7
Predicted Effect probably benign
Transcript: ENSMUST00000068296
AA Change: D189G

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000066012
Gene: ENSMUSG00000060510
AA Change: D189G

DomainStartEndE-ValueType
KRAB 41 101 1.4e-27 SMART
internal_repeat_1 138 318 2.7e-16 PROSPERO
ZnF_C2H2 343 365 7.78e-3 SMART
ZnF_C2H2 371 393 1.98e-4 SMART
ZnF_C2H2 399 421 2.27e-4 SMART
ZnF_C2H2 427 449 2.47e-5 SMART
ZnF_C2H2 455 477 2.99e-4 SMART
ZnF_C2H2 483 505 1.47e-3 SMART
ZnF_C2H2 511 533 5.81e-2 SMART
ZnF_C2H2 539 561 2.79e-4 SMART
ZnF_C2H2 567 589 2.09e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174462
AA Change: D189G

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000134217
Gene: ENSMUSG00000060510
AA Change: D189G

DomainStartEndE-ValueType
KRAB 41 101 1.4e-27 SMART
internal_repeat_1 138 318 2.7e-16 PROSPERO
ZnF_C2H2 343 365 7.78e-3 SMART
ZnF_C2H2 371 393 1.98e-4 SMART
ZnF_C2H2 399 421 2.27e-4 SMART
ZnF_C2H2 427 449 2.47e-5 SMART
ZnF_C2H2 455 477 2.99e-4 SMART
ZnF_C2H2 483 505 1.47e-3 SMART
ZnF_C2H2 511 533 5.81e-2 SMART
ZnF_C2H2 539 561 2.79e-4 SMART
ZnF_C2H2 567 589 2.09e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing many tandem zinc-finger motifs. Zinc fingers are protein or nucleic acid-binding domains, and may be involved in a variety of functions, including regulation of transcription. This gene is located in a cluster of similar genes encoding zinc finger proteins on chromosome 19. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4a T A 12: 71,106,889 (GRCm39) Y320* probably null Het
Ash1l T A 3: 88,960,062 (GRCm39) C2265S probably damaging Het
Atg4b T A 1: 93,713,694 (GRCm39) C55* probably null Het
Cacna1s A T 1: 136,005,430 (GRCm39) N405I probably benign Het
Capn11 A T 17: 45,944,325 (GRCm39) D526E probably damaging Het
Ccdc188 A G 16: 18,036,244 (GRCm39) R71G probably benign Het
Ccser2 G A 14: 36,618,220 (GRCm39) R772W probably damaging Het
Cenpf T A 1: 189,414,600 (GRCm39) E172D probably benign Het
Cep85 T C 4: 133,861,400 (GRCm39) M627V probably null Het
Chd1 G A 17: 17,594,737 (GRCm39) probably benign Het
Cnst A G 1: 179,437,759 (GRCm39) H441R probably benign Het
Cyp2d11 G T 15: 82,274,638 (GRCm39) T313N probably damaging Het
Cyp2g1 A G 7: 26,514,159 (GRCm39) N255S possibly damaging Het
Dnah5 A G 15: 28,453,414 (GRCm39) D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 75,874,624 (GRCm39) probably benign Het
Fcnb C T 2: 27,968,330 (GRCm39) S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,217,364 (GRCm39) probably null Het
Lama4 A G 10: 38,954,716 (GRCm39) S1090G probably damaging Het
Malrd1 A G 2: 15,929,931 (GRCm39) D1479G unknown Het
Man2a2 T C 7: 80,010,766 (GRCm39) K742E probably benign Het
Mapk8 A T 14: 33,104,241 (GRCm39) S392T probably benign Het
Mark3 T C 12: 111,559,117 (GRCm39) I53T probably damaging Het
Mcmdc2 A G 1: 9,986,867 (GRCm39) I219V probably benign Het
Mlycd A T 8: 120,134,332 (GRCm39) E278V probably benign Het
Muc2 G T 7: 141,290,801 (GRCm39) C29F Het
Mup20 T C 4: 61,971,721 (GRCm39) I77V probably benign Het
Myh3 A G 11: 66,982,828 (GRCm39) E849G probably damaging Het
Nedd4 A G 9: 72,593,389 (GRCm39) N154S probably damaging Het
Odad4 G A 11: 100,454,502 (GRCm39) G429E probably benign Het
Or1e1f A T 11: 73,856,240 (GRCm39) I269F probably benign Het
Pcdh7 A T 5: 57,877,678 (GRCm39) N411I probably damaging Het
Plekhm1 A G 11: 103,285,886 (GRCm39) I183T possibly damaging Het
Prkar2a G A 9: 108,569,710 (GRCm39) V19M probably damaging Het
Prss35 T G 9: 86,637,666 (GRCm39) N145K possibly damaging Het
Ranbp2 T A 10: 58,291,747 (GRCm39) D251E possibly damaging Het
Rnf169 C A 7: 99,575,651 (GRCm39) V315F probably damaging Het
Slc32a1 T C 2: 158,455,761 (GRCm39) Y139H probably damaging Het
Slc5a2 T C 7: 127,870,328 (GRCm39) V522A probably benign Het
Slc6a6 A T 6: 91,717,952 (GRCm39) Q297L probably damaging Het
Sos2 A C 12: 69,645,598 (GRCm39) Y914D probably damaging Het
Spata1 G T 3: 146,195,614 (GRCm39) T32N possibly damaging Het
Srcap C T 7: 127,138,369 (GRCm39) R1180C probably damaging Het
St14 A T 9: 31,042,921 (GRCm39) M1K probably null Het
Tcaf1 T C 6: 42,652,236 (GRCm39) T749A probably benign Het
Tcp1 T C 17: 13,141,621 (GRCm39) probably null Het
Tle6 A G 10: 81,426,888 (GRCm39) V576A probably damaging Het
Usp17lc T A 7: 103,067,407 (GRCm39) M234K probably benign Het
Washc4 A G 10: 83,416,163 (GRCm39) I818V possibly damaging Het
Zdhhc18 A G 4: 133,341,165 (GRCm39) L236P probably damaging Het
Zfp474 A T 18: 52,772,229 (GRCm39) D294V probably damaging Het
Zfp568 T C 7: 29,722,758 (GRCm39) F568L probably damaging Het
Zfp93 A G 7: 23,975,479 (GRCm39) K488R probably benign Het
Other mutations in Zfp266
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4453001:Zfp266 UTSW 9 20,417,299 (GRCm39) missense probably benign
R0744:Zfp266 UTSW 9 20,411,095 (GRCm39) missense probably damaging 1.00
R0836:Zfp266 UTSW 9 20,411,095 (GRCm39) missense probably damaging 1.00
R2180:Zfp266 UTSW 9 20,410,975 (GRCm39) missense probably damaging 1.00
R2422:Zfp266 UTSW 9 20,410,558 (GRCm39) missense possibly damaging 0.89
R3085:Zfp266 UTSW 9 20,412,240 (GRCm39) missense probably damaging 0.99
R3791:Zfp266 UTSW 9 20,410,777 (GRCm39) missense probably damaging 0.99
R3972:Zfp266 UTSW 9 20,411,446 (GRCm39) missense probably damaging 1.00
R5378:Zfp266 UTSW 9 20,410,659 (GRCm39) missense probably damaging 1.00
R5529:Zfp266 UTSW 9 20,418,030 (GRCm39) missense probably damaging 0.99
R5788:Zfp266 UTSW 9 20,417,332 (GRCm39) missense probably damaging 0.98
R6476:Zfp266 UTSW 9 20,410,577 (GRCm39) missense probably damaging 1.00
R6901:Zfp266 UTSW 9 20,410,895 (GRCm39) nonsense probably null
R7326:Zfp266 UTSW 9 20,413,391 (GRCm39) missense probably benign 0.03
R7417:Zfp266 UTSW 9 20,412,232 (GRCm39) missense probably benign
R7783:Zfp266 UTSW 9 20,411,626 (GRCm39) missense probably benign 0.04
R7917:Zfp266 UTSW 9 20,416,423 (GRCm39) missense probably benign 0.00
R7947:Zfp266 UTSW 9 20,410,548 (GRCm39) missense probably benign 0.00
R8174:Zfp266 UTSW 9 20,418,110 (GRCm39) start gained probably benign
R8776:Zfp266 UTSW 9 20,411,509 (GRCm39) missense probably benign 0.03
R8776-TAIL:Zfp266 UTSW 9 20,411,509 (GRCm39) missense probably benign 0.03
R8872:Zfp266 UTSW 9 20,411,275 (GRCm39) missense probably benign 0.22
R9096:Zfp266 UTSW 9 20,416,440 (GRCm39) missense probably damaging 1.00
R9220:Zfp266 UTSW 9 20,413,337 (GRCm39) nonsense probably null
R9284:Zfp266 UTSW 9 20,411,300 (GRCm39) nonsense probably null
R9502:Zfp266 UTSW 9 20,413,413 (GRCm39) nonsense probably null
R9547:Zfp266 UTSW 9 20,411,746 (GRCm39) missense probably benign 0.40
R9550:Zfp266 UTSW 9 20,410,482 (GRCm39) missense probably damaging 1.00
R9752:Zfp266 UTSW 9 20,411,496 (GRCm39) missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- CCCGTATTTACTCCAGTCAAAGG -3'
(R):5'- TTCTCAGGTGGGTGACTCATCTC -3'

Sequencing Primer
(F):5'- GCCTCATATCTGGCTGAAAGTAAGAC -3'
(R):5'- ATCTCTTCACGAGCAGTCAGG -3'
Posted On 2020-07-13