Mutagenetix > Incidental Mutation

Incidental Mutation 'R8194:Prkar2a'

635354

Institutional Source

Beutler Lab

Gene Symbol

Prkar2a

Ensembl Gene

ENSMUSG00000032601

Gene Name

protein kinase, cAMP dependent regulatory, type II alpha

Synonyms

1110061A24Rik, RII(alpha)

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8194 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

108689314-108750436 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 108692511 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 19 (V19M)

Ref Sequence

ENSEMBL: ENSMUSP00000035220 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035220] [ENSMUST00000192344] [ENSMUST00000195405]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000035220
AA Change: V19M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000035220
Gene: ENSMUSG00000032601
AA Change: V19M

Domain	Start	End	E-Value	Type
RIIa	8	45	7.15e-16	SMART
low complexity region	70	85	N/A	INTRINSIC
low complexity region	104	114	N/A	INTRINSIC
cNMP	137	257	2.27e-23	SMART
cNMP	259	384	2.02e-29	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000192344

Predicted Effect

probably damaging
Transcript: ENSMUST00000195405
AA Change: V19M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000141869
Gene: ENSMUSG00000032601
AA Change: V19M

Domain	Start	End	E-Value	Type
RIIa	8	45	4.3e-18	SMART
low complexity region	70	85	N/A	INTRINSIC
low complexity region	104	114	N/A	INTRINSIC
cNMP	137	257	1.1e-25	SMART
cNMP	259	362	3.9e-12	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. The protein encoded by this gene is one of the regulatory subunits. This subunit can be phosphorylated by the activated catalytic subunit. It may interact with various A-kinase anchoring proteins and determine the subcellular localization of cAMP-dependent protein kinase. This subunit has been shown to regulate protein transport from endosomes to the Golgi apparatus and further to the endoplasmic reticulum (ER). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and appear healthy. They have normal growth and no deficits in locomotor activity, muscle strength, or exploratory behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arid4a	T	A	12: 71,060,115	Y320*	probably null	Het
Ash1l	T	A	3: 89,052,755	C2265S	probably damaging	Het
Atg4b	T	A	1: 93,785,972	C55*	probably null	Het
Cacna1s	A	T	1: 136,077,692	N405I	probably benign	Het
Capn11	A	T	17: 45,633,399	D526E	probably damaging	Het
Ccdc188	A	G	16: 18,218,380	R71G	probably benign	Het
Ccser2	G	A	14: 36,896,263	R772W	probably damaging	Het
Cenpf	T	A	1: 189,682,403	E172D	probably benign	Het
Cep85	T	C	4: 134,134,089	M627V	probably null	Het
Chd1	G	A	17: 17,374,475		probably benign	Het
Cnst	A	G	1: 179,610,194	H441R	probably benign	Het
Cyp2d11	G	T	15: 82,390,437	T313N	probably damaging	Het
Cyp2g1	A	G	7: 26,814,734	N255S	possibly damaging	Het
Dnah5	A	G	15: 28,453,268	D4395G	probably damaging	Het
Fam83h	ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT	ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT	15: 76,002,775		probably benign	Het
Fcnb	C	T	2: 28,078,318	S209N	possibly damaging	Het
Gpsm1	CT	CTT	2: 26,327,352		probably null	Het
Lama4	A	G	10: 39,078,720	S1090G	probably damaging	Het
Malrd1	A	G	2: 15,925,120	D1479G	unknown	Het
Man2a2	T	C	7: 80,361,018	K742E	probably benign	Het
Mapk8	A	T	14: 33,382,284	S392T	probably benign	Het
Mark3	T	C	12: 111,592,683	I53T	probably damaging	Het
Mcmdc2	A	G	1: 9,916,642	I219V	probably benign	Het
Mlycd	A	T	8: 119,407,593	E278V	probably benign	Het
Muc2	G	T	7: 141,704,252	C29F		Het
Mup20	T	C	4: 62,053,484	I77V	probably benign	Het
Myh3	A	G	11: 67,092,002	E849G	probably damaging	Het
Nedd4	A	G	9: 72,686,107	N154S	probably damaging	Het
Olfr397	A	T	11: 73,965,414	I269F	probably benign	Het
Pcdh7	A	T	5: 57,720,336	N411I	probably damaging	Het
Plekhm1	A	G	11: 103,395,060	I183T	possibly damaging	Het
Prss35	T	G	9: 86,755,613	N145K	possibly damaging	Het
Ranbp2	T	A	10: 58,455,925	D251E	possibly damaging	Het
Rnf169	C	A	7: 99,926,444	V315F	probably damaging	Het
Slc32a1	T	C	2: 158,613,841	Y139H	probably damaging	Het
Slc5a2	T	C	7: 128,271,156	V522A	probably benign	Het
Slc6a6	A	T	6: 91,740,971	Q297L	probably damaging	Het
Sos2	A	C	12: 69,598,824	Y914D	probably damaging	Het
Spata1	G	T	3: 146,489,859	T32N	possibly damaging	Het
Srcap	C	T	7: 127,539,197	R1180C	probably damaging	Het
St14	A	T	9: 31,131,625	M1K	probably null	Het
Tcaf1	T	C	6: 42,675,302	T749A	probably benign	Het
Tcp1	T	C	17: 12,922,734		probably null	Het
Tle6	A	G	10: 81,591,054	V576A	probably damaging	Het
Ttc25	G	A	11: 100,563,676	G429E	probably benign	Het
Usp17lc	T	A	7: 103,418,200	M234K	probably benign	Het
Washc4	A	G	10: 83,580,299	I818V	possibly damaging	Het
Zdhhc18	A	G	4: 133,613,854	L236P	probably damaging	Het
Zfp266	T	C	9: 20,500,314	D189G	probably benign	Het
Zfp474	A	T	18: 52,639,157	D294V	probably damaging	Het
Zfp568	T	C	7: 30,023,333	F568L	probably damaging	Het
Zfp93	A	G	7: 24,276,054	K488R	probably benign	Het

Other mutations in Prkar2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02064:Prkar2a	APN	9	108733204	missense	possibly damaging	0.92
IGL02073:Prkar2a	APN	9	108733123	missense	probably damaging	0.99
IGL02117:Prkar2a	APN	9	108719261	missense	probably damaging	1.00
IGL02268:Prkar2a	APN	9	108746953	missense	probably benign	0.04
IGL02635:Prkar2a	APN	9	108728277	missense	probably damaging	0.99
IGL03006:Prkar2a	APN	9	108740441	missense	probably benign
PIT4486001:Prkar2a	UTSW	9	108733127	missense	probably damaging	1.00
R0335:Prkar2a	UTSW	9	108719258	missense	probably damaging	1.00
R0920:Prkar2a	UTSW	9	108719297	splice site	probably benign
R0943:Prkar2a	UTSW	9	108733276	splice site	probably benign
R1513:Prkar2a	UTSW	9	108728270	missense	possibly damaging	0.82
R2178:Prkar2a	UTSW	9	108740538	critical splice donor site	probably null
R3820:Prkar2a	UTSW	9	108746956	missense	probably damaging	1.00
R3842:Prkar2a	UTSW	9	108728268	missense	probably damaging	1.00
R4807:Prkar2a	UTSW	9	108740385	intron	probably benign
R4886:Prkar2a	UTSW	9	108745624	critical splice donor site	probably null
R5051:Prkar2a	UTSW	9	108745491	missense	probably benign	0.00
R5435:Prkar2a	UTSW	9	108740483	missense	probably damaging	1.00
R6979:Prkar2a	UTSW	9	108733143	missense	possibly damaging	0.76
R7121:Prkar2a	UTSW	9	108692622	missense	probably benign
R7199:Prkar2a	UTSW	9	108740470	missense	probably damaging	1.00
R7819:Prkar2a	UTSW	9	108745545	missense	probably damaging	1.00
R8218:Prkar2a	UTSW	9	108719249	missense	possibly damaging	0.83
R8253:Prkar2a	UTSW	9	108740439	missense	probably damaging	1.00
X0060:Prkar2a	UTSW	9	108745582	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGACCCGGCCAGAATAAG -3'
(R):5'- CTACCTTCCAGATCGGCATC -3'

Sequencing Primer
(F):5'- GCCAGAATAAGGCGCGAC -3'
(R):5'- GCATCTTCCGAGTCCGAGTCAC -3'

Posted On

2020-07-13