Incidental Mutation 'R8194:Prkar2a'
ID635354
Institutional Source Beutler Lab
Gene Symbol Prkar2a
Ensembl Gene ENSMUSG00000032601
Gene Nameprotein kinase, cAMP dependent regulatory, type II alpha
Synonyms1110061A24Rik, RII(alpha)
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8194 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location108689314-108750436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108692511 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 19 (V19M)
Ref Sequence ENSEMBL: ENSMUSP00000035220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035220] [ENSMUST00000192344] [ENSMUST00000195405]
Predicted Effect probably damaging
Transcript: ENSMUST00000035220
AA Change: V19M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035220
Gene: ENSMUSG00000032601
AA Change: V19M

DomainStartEndE-ValueType
RIIa 8 45 7.15e-16 SMART
low complexity region 70 85 N/A INTRINSIC
low complexity region 104 114 N/A INTRINSIC
cNMP 137 257 2.27e-23 SMART
cNMP 259 384 2.02e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192344
Predicted Effect probably damaging
Transcript: ENSMUST00000195405
AA Change: V19M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141869
Gene: ENSMUSG00000032601
AA Change: V19M

DomainStartEndE-ValueType
RIIa 8 45 4.3e-18 SMART
low complexity region 70 85 N/A INTRINSIC
low complexity region 104 114 N/A INTRINSIC
cNMP 137 257 1.1e-25 SMART
cNMP 259 362 3.9e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. The protein encoded by this gene is one of the regulatory subunits. This subunit can be phosphorylated by the activated catalytic subunit. It may interact with various A-kinase anchoring proteins and determine the subcellular localization of cAMP-dependent protein kinase. This subunit has been shown to regulate protein transport from endosomes to the Golgi apparatus and further to the endoplasmic reticulum (ER). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and appear healthy. They have normal growth and no deficits in locomotor activity, muscle strength, or exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230046K03Rik A G 10: 83,580,299 I818V possibly damaging Het
Arid4a T A 12: 71,060,115 Y320* probably null Het
Ash1l T A 3: 89,052,755 C2265S probably damaging Het
Atg4b T A 1: 93,785,972 C55* probably null Het
Cacna1s A T 1: 136,077,692 N405I probably benign Het
Capn11 A T 17: 45,633,399 D526E probably damaging Het
Ccdc188 A G 16: 18,218,380 R71G probably benign Het
Ccser2 G A 14: 36,896,263 R772W probably damaging Het
Cenpf T A 1: 189,682,403 E172D probably benign Het
Cep85 T C 4: 134,134,089 M627V probably null Het
Chd1 G A 17: 17,374,475 probably benign Het
Cnst A G 1: 179,610,194 H441R probably benign Het
Cyp2d11 G T 15: 82,390,437 T313N probably damaging Het
Cyp2g1 A G 7: 26,814,734 N255S possibly damaging Het
Dnah5 A G 15: 28,453,268 D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,327,352 probably null Het
Lama4 A G 10: 39,078,720 S1090G probably damaging Het
Malrd1 A G 2: 15,925,120 D1479G unknown Het
Man2a2 T C 7: 80,361,018 K742E probably benign Het
Mapk8 A T 14: 33,382,284 S392T probably benign Het
Mark3 T C 12: 111,592,683 I53T probably damaging Het
Mcmdc2 A G 1: 9,916,642 I219V probably benign Het
Mlycd A T 8: 119,407,593 E278V probably benign Het
Muc2 G T 7: 141,704,252 C29F Het
Mup20 T C 4: 62,053,484 I77V probably benign Het
Myh3 A G 11: 67,092,002 E849G probably damaging Het
Nedd4 A G 9: 72,686,107 N154S probably damaging Het
Olfr397 A T 11: 73,965,414 I269F probably benign Het
Pcdh7 A T 5: 57,720,336 N411I probably damaging Het
Plekhm1 A G 11: 103,395,060 I183T possibly damaging Het
Prss35 T G 9: 86,755,613 N145K possibly damaging Het
Ranbp2 T A 10: 58,455,925 D251E possibly damaging Het
Rnf169 C A 7: 99,926,444 V315F probably damaging Het
Slc32a1 T C 2: 158,613,841 Y139H probably damaging Het
Slc5a2 T C 7: 128,271,156 V522A probably benign Het
Slc6a6 A T 6: 91,740,971 Q297L probably damaging Het
Sos2 A C 12: 69,598,824 Y914D probably damaging Het
Spata1 G T 3: 146,489,859 T32N possibly damaging Het
Srcap C T 7: 127,539,197 R1180C probably damaging Het
St14 A T 9: 31,131,625 M1K probably null Het
Tcaf1 T C 6: 42,675,302 T749A probably benign Het
Tcp1 T C 17: 12,922,734 probably null Het
Tle6 A G 10: 81,591,054 V576A probably damaging Het
Ttc25 G A 11: 100,563,676 G429E probably benign Het
Usp17lc T A 7: 103,418,200 M234K probably benign Het
Zdhhc18 A G 4: 133,613,854 L236P probably damaging Het
Zfp266 T C 9: 20,500,314 D189G probably benign Het
Zfp474 A T 18: 52,639,157 D294V probably damaging Het
Zfp568 T C 7: 30,023,333 F568L probably damaging Het
Zfp93 A G 7: 24,276,054 K488R probably benign Het
Other mutations in Prkar2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:Prkar2a APN 9 108733204 missense possibly damaging 0.92
IGL02073:Prkar2a APN 9 108733123 missense probably damaging 0.99
IGL02117:Prkar2a APN 9 108719261 missense probably damaging 1.00
IGL02268:Prkar2a APN 9 108746953 missense probably benign 0.04
IGL02635:Prkar2a APN 9 108728277 missense probably damaging 0.99
IGL03006:Prkar2a APN 9 108740441 missense probably benign
PIT4486001:Prkar2a UTSW 9 108733127 missense probably damaging 1.00
R0335:Prkar2a UTSW 9 108719258 missense probably damaging 1.00
R0920:Prkar2a UTSW 9 108719297 splice site probably benign
R0943:Prkar2a UTSW 9 108733276 splice site probably benign
R1513:Prkar2a UTSW 9 108728270 missense possibly damaging 0.82
R2178:Prkar2a UTSW 9 108740538 critical splice donor site probably null
R3820:Prkar2a UTSW 9 108746956 missense probably damaging 1.00
R3842:Prkar2a UTSW 9 108728268 missense probably damaging 1.00
R4807:Prkar2a UTSW 9 108740385 intron probably benign
R4886:Prkar2a UTSW 9 108745624 critical splice donor site probably null
R5051:Prkar2a UTSW 9 108745491 missense probably benign 0.00
R5435:Prkar2a UTSW 9 108740483 missense probably damaging 1.00
R6979:Prkar2a UTSW 9 108733143 missense possibly damaging 0.76
R7121:Prkar2a UTSW 9 108692622 missense probably benign
R7199:Prkar2a UTSW 9 108740470 missense probably damaging 1.00
R7819:Prkar2a UTSW 9 108745545 missense probably damaging 1.00
R8218:Prkar2a UTSW 9 108719249 missense possibly damaging 0.83
R8253:Prkar2a UTSW 9 108740439 missense probably damaging 1.00
X0060:Prkar2a UTSW 9 108745582 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGACCCGGCCAGAATAAG -3'
(R):5'- CTACCTTCCAGATCGGCATC -3'

Sequencing Primer
(F):5'- GCCAGAATAAGGCGCGAC -3'
(R):5'- GCATCTTCCGAGTCCGAGTCAC -3'
Posted On2020-07-13