Incidental Mutation 'R8194:Olfr397'
ID635360
Institutional Source Beutler Lab
Gene Symbol Olfr397
Ensembl Gene ENSMUSG00000057050
Gene Nameolfactory receptor 397
SynonymsGA_x6K02T2P1NL-4121434-4122381, MOR135-28
MMRRC Submission
Accession Numbers

Genbank: NM_146346; MGI: 3030231

Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R8194 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location73960817-73967812 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73965414 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 269 (I269F)
Ref Sequence ENSEMBL: ENSMUSP00000113870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121280]
Predicted Effect probably benign
Transcript: ENSMUST00000121280
AA Change: I269F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113870
Gene: ENSMUSG00000057050
AA Change: I269F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 305 1.3e-6 PFAM
Pfam:7tm_1 41 290 4.3e-35 PFAM
Pfam:7tm_4 139 283 1.2e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230046K03Rik A G 10: 83,580,299 I818V possibly damaging Het
Arid4a T A 12: 71,060,115 Y320* probably null Het
Ash1l T A 3: 89,052,755 C2265S probably damaging Het
Atg4b T A 1: 93,785,972 C55* probably null Het
Cacna1s A T 1: 136,077,692 N405I probably benign Het
Capn11 A T 17: 45,633,399 D526E probably damaging Het
Ccdc188 A G 16: 18,218,380 R71G probably benign Het
Ccser2 G A 14: 36,896,263 R772W probably damaging Het
Cenpf T A 1: 189,682,403 E172D probably benign Het
Cep85 T C 4: 134,134,089 M627V probably null Het
Chd1 G A 17: 17,374,475 probably benign Het
Cnst A G 1: 179,610,194 H441R probably benign Het
Cyp2d11 G T 15: 82,390,437 T313N probably damaging Het
Cyp2g1 A G 7: 26,814,734 N255S possibly damaging Het
Dnah5 A G 15: 28,453,268 D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,327,352 probably null Het
Lama4 A G 10: 39,078,720 S1090G probably damaging Het
Malrd1 A G 2: 15,925,120 D1479G unknown Het
Man2a2 T C 7: 80,361,018 K742E probably benign Het
Mapk8 A T 14: 33,382,284 S392T probably benign Het
Mark3 T C 12: 111,592,683 I53T probably damaging Het
Mcmdc2 A G 1: 9,916,642 I219V probably benign Het
Mlycd A T 8: 119,407,593 E278V probably benign Het
Muc2 G T 7: 141,704,252 C29F Het
Mup20 T C 4: 62,053,484 I77V probably benign Het
Myh3 A G 11: 67,092,002 E849G probably damaging Het
Nedd4 A G 9: 72,686,107 N154S probably damaging Het
Pcdh7 A T 5: 57,720,336 N411I probably damaging Het
Plekhm1 A G 11: 103,395,060 I183T possibly damaging Het
Prkar2a G A 9: 108,692,511 V19M probably damaging Het
Prss35 T G 9: 86,755,613 N145K possibly damaging Het
Ranbp2 T A 10: 58,455,925 D251E possibly damaging Het
Rnf169 C A 7: 99,926,444 V315F probably damaging Het
Slc32a1 T C 2: 158,613,841 Y139H probably damaging Het
Slc5a2 T C 7: 128,271,156 V522A probably benign Het
Slc6a6 A T 6: 91,740,971 Q297L probably damaging Het
Sos2 A C 12: 69,598,824 Y914D probably damaging Het
Spata1 G T 3: 146,489,859 T32N possibly damaging Het
Srcap C T 7: 127,539,197 R1180C probably damaging Het
St14 A T 9: 31,131,625 M1K probably null Het
Tcaf1 T C 6: 42,675,302 T749A probably benign Het
Tcp1 T C 17: 12,922,734 probably null Het
Tle6 A G 10: 81,591,054 V576A probably damaging Het
Ttc25 G A 11: 100,563,676 G429E probably benign Het
Usp17lc T A 7: 103,418,200 M234K probably benign Het
Zdhhc18 A G 4: 133,613,854 L236P probably damaging Het
Zfp266 T C 9: 20,500,314 D189G probably benign Het
Zfp474 A T 18: 52,639,157 D294V probably damaging Het
Zfp568 T C 7: 30,023,333 F568L probably damaging Het
Zfp93 A G 7: 24,276,054 K488R probably benign Het
Other mutations in Olfr397
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01797:Olfr397 APN 11 73964818 missense probably damaging 1.00
IGL01839:Olfr397 APN 11 73964611 start codon destroyed probably null 1.00
IGL02247:Olfr397 APN 11 73964862 missense probably benign 0.05
IGL02876:Olfr397 APN 11 73964713 missense possibly damaging 0.95
IGL03051:Olfr397 APN 11 73965034 missense probably benign 0.04
IGL03123:Olfr397 APN 11 73964986 missense probably damaging 1.00
IGL03401:Olfr397 APN 11 73965562 utr 3 prime probably benign
3-1:Olfr397 UTSW 11 73964977 missense possibly damaging 0.84
R0496:Olfr397 UTSW 11 73964880 missense probably benign 0.42
R0811:Olfr397 UTSW 11 73965420 missense probably benign 0.02
R0812:Olfr397 UTSW 11 73965420 missense probably benign 0.02
R1503:Olfr397 UTSW 11 73964568 utr 5 prime probably null
R2067:Olfr397 UTSW 11 73964914 missense probably damaging 1.00
R2111:Olfr397 UTSW 11 73964914 missense probably damaging 1.00
R4912:Olfr397 UTSW 11 73965340 missense probably damaging 1.00
R5240:Olfr397 UTSW 11 73964806 missense probably damaging 1.00
R5656:Olfr397 UTSW 11 73964710 missense probably damaging 0.99
R5801:Olfr397 UTSW 11 73964946 missense probably benign 0.39
R6329:Olfr397 UTSW 11 73964742 missense possibly damaging 0.73
R6720:Olfr397 UTSW 11 73965465 missense probably damaging 1.00
R7149:Olfr397 UTSW 11 73965431 missense probably benign 0.01
R7283:Olfr397 UTSW 11 73964808 missense probably damaging 1.00
Z1176:Olfr397 UTSW 11 73965297 frame shift probably null
Z1177:Olfr397 UTSW 11 73964760 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGACTTGTCATTATTGTCCCATTC -3'
(R):5'- AAGCCCCTGCATACCATTTG -3'

Sequencing Primer
(F):5'- CCTGCTGATATTTTCATCCTATGCAC -3'
(R):5'- CCCTGCATACCATTTGAAATTGGG -3'
Posted On2020-07-13