Incidental Mutation 'R8194:Ttc25'
ID 635361
Institutional Source Beutler Lab
Gene Symbol Ttc25
Ensembl Gene ENSMUSG00000006784
Gene Name tetratricopeptide repeat domain 25
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock # R8194 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 100545607-100572568 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 100563676 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 429 (G429E)
Ref Sequence ENSEMBL: ENSMUSP00000090355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006976] [ENSMUST00000092684]
AlphaFold Q9D4B2
Predicted Effect probably benign
Transcript: ENSMUST00000006976
AA Change: G429E

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000006976
Gene: ENSMUSG00000006784
AA Change: G429E

DomainStartEndE-ValueType
TPR 11 44 3.69e1 SMART
TPR 45 78 3.07e1 SMART
TPR 79 112 4.96e0 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
TPR 318 351 4.96e0 SMART
TPR 358 391 1.11e1 SMART
Blast:TPR 395 428 7e-14 BLAST
TPR 435 468 2.99e1 SMART
low complexity region 493 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092684
AA Change: G429E

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000090355
Gene: ENSMUSG00000006784
AA Change: G429E

DomainStartEndE-ValueType
TPR 11 44 3.69e1 SMART
TPR 45 78 3.07e1 SMART
TPR 79 112 4.96e0 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
TPR 318 351 4.96e0 SMART
TPR 358 391 1.11e1 SMART
Blast:TPR 395 428 5e-14 BLAST
TPR 435 468 2.99e1 SMART
coiled coil region 528 548 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
coiled coil region 599 624 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display partial preweaning lethality, impaired ciliary motility, and a variety of left-right body symmetry defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230046K03Rik A G 10: 83,580,299 I818V possibly damaging Het
Arid4a T A 12: 71,060,115 Y320* probably null Het
Ash1l T A 3: 89,052,755 C2265S probably damaging Het
Atg4b T A 1: 93,785,972 C55* probably null Het
Cacna1s A T 1: 136,077,692 N405I probably benign Het
Capn11 A T 17: 45,633,399 D526E probably damaging Het
Ccdc188 A G 16: 18,218,380 R71G probably benign Het
Ccser2 G A 14: 36,896,263 R772W probably damaging Het
Cenpf T A 1: 189,682,403 E172D probably benign Het
Cep85 T C 4: 134,134,089 M627V probably null Het
Chd1 G A 17: 17,374,475 probably benign Het
Cnst A G 1: 179,610,194 H441R probably benign Het
Cyp2d11 G T 15: 82,390,437 T313N probably damaging Het
Cyp2g1 A G 7: 26,814,734 N255S possibly damaging Het
Dnah5 A G 15: 28,453,268 D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,327,352 probably null Het
Lama4 A G 10: 39,078,720 S1090G probably damaging Het
Malrd1 A G 2: 15,925,120 D1479G unknown Het
Man2a2 T C 7: 80,361,018 K742E probably benign Het
Mapk8 A T 14: 33,382,284 S392T probably benign Het
Mark3 T C 12: 111,592,683 I53T probably damaging Het
Mcmdc2 A G 1: 9,916,642 I219V probably benign Het
Mlycd A T 8: 119,407,593 E278V probably benign Het
Muc2 G T 7: 141,704,252 C29F Het
Mup20 T C 4: 62,053,484 I77V probably benign Het
Myh3 A G 11: 67,092,002 E849G probably damaging Het
Nedd4 A G 9: 72,686,107 N154S probably damaging Het
Olfr397 A T 11: 73,965,414 I269F probably benign Het
Pcdh7 A T 5: 57,720,336 N411I probably damaging Het
Plekhm1 A G 11: 103,395,060 I183T possibly damaging Het
Prkar2a G A 9: 108,692,511 V19M probably damaging Het
Prss35 T G 9: 86,755,613 N145K possibly damaging Het
Ranbp2 T A 10: 58,455,925 D251E possibly damaging Het
Rnf169 C A 7: 99,926,444 V315F probably damaging Het
Slc32a1 T C 2: 158,613,841 Y139H probably damaging Het
Slc5a2 T C 7: 128,271,156 V522A probably benign Het
Slc6a6 A T 6: 91,740,971 Q297L probably damaging Het
Sos2 A C 12: 69,598,824 Y914D probably damaging Het
Spata1 G T 3: 146,489,859 T32N possibly damaging Het
Srcap C T 7: 127,539,197 R1180C probably damaging Het
St14 A T 9: 31,131,625 M1K probably null Het
Tcaf1 T C 6: 42,675,302 T749A probably benign Het
Tcp1 T C 17: 12,922,734 probably null Het
Tle6 A G 10: 81,591,054 V576A probably damaging Het
Usp17lc T A 7: 103,418,200 M234K probably benign Het
Zdhhc18 A G 4: 133,613,854 L236P probably damaging Het
Zfp266 T C 9: 20,500,314 D189G probably benign Het
Zfp474 A T 18: 52,639,157 D294V probably damaging Het
Zfp568 T C 7: 30,023,333 F568L probably damaging Het
Zfp93 A G 7: 24,276,054 K488R probably benign Het
Other mutations in Ttc25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Ttc25 APN 11 100569902 missense probably damaging 1.00
IGL02379:Ttc25 APN 11 100566983 missense possibly damaging 0.87
IGL03091:Ttc25 APN 11 100550250 nonsense probably null
IGL02991:Ttc25 UTSW 11 100553872 missense probably benign 0.01
R0044:Ttc25 UTSW 11 100567001 missense probably damaging 1.00
R0137:Ttc25 UTSW 11 100563568 missense probably damaging 1.00
R0280:Ttc25 UTSW 11 100550265 missense probably damaging 1.00
R1373:Ttc25 UTSW 11 100545832 missense probably damaging 1.00
R1793:Ttc25 UTSW 11 100569853 splice site probably null
R2097:Ttc25 UTSW 11 100563582 missense possibly damaging 0.89
R2121:Ttc25 UTSW 11 100567011 critical splice donor site probably null
R2509:Ttc25 UTSW 11 100553535 missense probably damaging 0.99
R2655:Ttc25 UTSW 11 100553579 missense probably damaging 1.00
R4635:Ttc25 UTSW 11 100551507 nonsense probably null
R4773:Ttc25 UTSW 11 100549916 missense probably benign 0.05
R4858:Ttc25 UTSW 11 100550321 missense probably damaging 0.96
R5164:Ttc25 UTSW 11 100571520 nonsense probably null
R5181:Ttc25 UTSW 11 100549893 missense probably damaging 1.00
R5707:Ttc25 UTSW 11 100554061 missense probably damaging 0.99
R5742:Ttc25 UTSW 11 100545873 missense possibly damaging 0.90
R7634:Ttc25 UTSW 11 100561905 critical splice donor site probably null
R7851:Ttc25 UTSW 11 100545829 missense probably damaging 1.00
R8186:Ttc25 UTSW 11 100563679 missense probably benign 0.27
R8444:Ttc25 UTSW 11 100561905 critical splice donor site probably null
R8879:Ttc25 UTSW 11 100566926 nonsense probably null
X0018:Ttc25 UTSW 11 100553598 missense probably damaging 0.99
X0028:Ttc25 UTSW 11 100545898 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGGAGCTGACCCGTTCTT -3'
(R):5'- TTAAAACAAAGCTGGGAGGTGGT -3'

Sequencing Primer
(F):5'- TCTTCTTCTCCCCAGGTGG -3'
(R):5'- CTTTAATCCCAGCACTAGGGAGG -3'
Posted On 2020-07-13