Incidental Mutation 'R8194:Ttc25'
ID635361
Institutional Source Beutler Lab
Gene Symbol Ttc25
Ensembl Gene ENSMUSG00000006784
Gene Nametetratricopeptide repeat domain 25
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R8194 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location100545607-100572568 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 100563676 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 429 (G429E)
Ref Sequence ENSEMBL: ENSMUSP00000090355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006976] [ENSMUST00000092684]
Predicted Effect probably benign
Transcript: ENSMUST00000006976
AA Change: G429E

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000006976
Gene: ENSMUSG00000006784
AA Change: G429E

DomainStartEndE-ValueType
TPR 11 44 3.69e1 SMART
TPR 45 78 3.07e1 SMART
TPR 79 112 4.96e0 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
TPR 318 351 4.96e0 SMART
TPR 358 391 1.11e1 SMART
Blast:TPR 395 428 7e-14 BLAST
TPR 435 468 2.99e1 SMART
low complexity region 493 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092684
AA Change: G429E

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000090355
Gene: ENSMUSG00000006784
AA Change: G429E

DomainStartEndE-ValueType
TPR 11 44 3.69e1 SMART
TPR 45 78 3.07e1 SMART
TPR 79 112 4.96e0 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
TPR 318 351 4.96e0 SMART
TPR 358 391 1.11e1 SMART
Blast:TPR 395 428 5e-14 BLAST
TPR 435 468 2.99e1 SMART
coiled coil region 528 548 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
coiled coil region 599 624 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display partial preweaning lethality, impaired ciliary motility, and a variety of left-right body symmetry defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230046K03Rik A G 10: 83,580,299 I818V possibly damaging Het
Arid4a T A 12: 71,060,115 Y320* probably null Het
Ash1l T A 3: 89,052,755 C2265S probably damaging Het
Atg4b T A 1: 93,785,972 C55* probably null Het
Cacna1s A T 1: 136,077,692 N405I probably benign Het
Capn11 A T 17: 45,633,399 D526E probably damaging Het
Ccdc188 A G 16: 18,218,380 R71G probably benign Het
Ccser2 G A 14: 36,896,263 R772W probably damaging Het
Cenpf T A 1: 189,682,403 E172D probably benign Het
Cep85 T C 4: 134,134,089 M627V probably null Het
Chd1 G A 17: 17,374,475 probably benign Het
Cnst A G 1: 179,610,194 H441R probably benign Het
Cyp2d11 G T 15: 82,390,437 T313N probably damaging Het
Cyp2g1 A G 7: 26,814,734 N255S possibly damaging Het
Dnah5 A G 15: 28,453,268 D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,327,352 probably null Het
Lama4 A G 10: 39,078,720 S1090G probably damaging Het
Malrd1 A G 2: 15,925,120 D1479G unknown Het
Man2a2 T C 7: 80,361,018 K742E probably benign Het
Mapk8 A T 14: 33,382,284 S392T probably benign Het
Mark3 T C 12: 111,592,683 I53T probably damaging Het
Mcmdc2 A G 1: 9,916,642 I219V probably benign Het
Mlycd A T 8: 119,407,593 E278V probably benign Het
Muc2 G T 7: 141,704,252 C29F Het
Mup20 T C 4: 62,053,484 I77V probably benign Het
Myh3 A G 11: 67,092,002 E849G probably damaging Het
Nedd4 A G 9: 72,686,107 N154S probably damaging Het
Olfr397 A T 11: 73,965,414 I269F probably benign Het
Pcdh7 A T 5: 57,720,336 N411I probably damaging Het
Plekhm1 A G 11: 103,395,060 I183T possibly damaging Het
Prkar2a G A 9: 108,692,511 V19M probably damaging Het
Prss35 T G 9: 86,755,613 N145K possibly damaging Het
Ranbp2 T A 10: 58,455,925 D251E possibly damaging Het
Rnf169 C A 7: 99,926,444 V315F probably damaging Het
Slc32a1 T C 2: 158,613,841 Y139H probably damaging Het
Slc5a2 T C 7: 128,271,156 V522A probably benign Het
Slc6a6 A T 6: 91,740,971 Q297L probably damaging Het
Sos2 A C 12: 69,598,824 Y914D probably damaging Het
Spata1 G T 3: 146,489,859 T32N possibly damaging Het
Srcap C T 7: 127,539,197 R1180C probably damaging Het
St14 A T 9: 31,131,625 M1K probably null Het
Tcaf1 T C 6: 42,675,302 T749A probably benign Het
Tcp1 T C 17: 12,922,734 probably null Het
Tle6 A G 10: 81,591,054 V576A probably damaging Het
Usp17lc T A 7: 103,418,200 M234K probably benign Het
Zdhhc18 A G 4: 133,613,854 L236P probably damaging Het
Zfp266 T C 9: 20,500,314 D189G probably benign Het
Zfp474 A T 18: 52,639,157 D294V probably damaging Het
Zfp568 T C 7: 30,023,333 F568L probably damaging Het
Zfp93 A G 7: 24,276,054 K488R probably benign Het
Other mutations in Ttc25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Ttc25 APN 11 100569902 missense probably damaging 1.00
IGL02379:Ttc25 APN 11 100566983 missense possibly damaging 0.87
IGL03091:Ttc25 APN 11 100550250 nonsense probably null
IGL02991:Ttc25 UTSW 11 100553872 missense probably benign 0.01
R0044:Ttc25 UTSW 11 100567001 missense probably damaging 1.00
R0137:Ttc25 UTSW 11 100563568 missense probably damaging 1.00
R0280:Ttc25 UTSW 11 100550265 missense probably damaging 1.00
R1373:Ttc25 UTSW 11 100545832 missense probably damaging 1.00
R1793:Ttc25 UTSW 11 100569853 splice site probably null
R2097:Ttc25 UTSW 11 100563582 missense possibly damaging 0.89
R2121:Ttc25 UTSW 11 100567011 critical splice donor site probably null
R2509:Ttc25 UTSW 11 100553535 missense probably damaging 0.99
R2655:Ttc25 UTSW 11 100553579 missense probably damaging 1.00
R4635:Ttc25 UTSW 11 100551507 nonsense probably null
R4773:Ttc25 UTSW 11 100549916 missense probably benign 0.05
R4858:Ttc25 UTSW 11 100550321 missense probably damaging 0.96
R5164:Ttc25 UTSW 11 100571520 nonsense probably null
R5181:Ttc25 UTSW 11 100549893 missense probably damaging 1.00
R5707:Ttc25 UTSW 11 100554061 missense probably damaging 0.99
R5742:Ttc25 UTSW 11 100545873 missense possibly damaging 0.90
R7634:Ttc25 UTSW 11 100561905 critical splice donor site probably null
R7851:Ttc25 UTSW 11 100545829 missense probably damaging 1.00
R8186:Ttc25 UTSW 11 100563679 missense probably benign 0.27
R8444:Ttc25 UTSW 11 100561905 critical splice donor site probably null
X0018:Ttc25 UTSW 11 100553598 missense probably damaging 0.99
X0028:Ttc25 UTSW 11 100545898 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGGAGCTGACCCGTTCTT -3'
(R):5'- TTAAAACAAAGCTGGGAGGTGGT -3'

Sequencing Primer
(F):5'- TCTTCTTCTCCCCAGGTGG -3'
(R):5'- CTTTAATCCCAGCACTAGGGAGG -3'
Posted On2020-07-13