Mutagenetix > Incidental Mutation

Incidental Mutation 'R8194:Sos2'

635363

Institutional Source

Beutler Lab

Gene Symbol

Sos2

Ensembl Gene

ENSMUSG00000034801

Gene Name

SOS Ras/Rho guanine nucleotide exchange factor 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8194 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

69583762-69681852 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 69598824 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Aspartic acid at position 914 (Y914D)

Ref Sequence

ENSEMBL: ENSMUSP00000138793 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035773] [ENSMUST00000182396] [ENSMUST00000183277]

AlphaFold

Q02384

PDB Structure

ORIENTATION OF PEPTIDE FRAGMENTS FROM SOS PROTEINS BOUND TO THE N-TERMINAL SH3 DOMAIN OF GRB2 DETERMINED BY NMR SPECTROSCOPY [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000035773
AA Change: Y913D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044866
Gene: ENSMUSG00000034801
AA Change: Y913D

Domain	Start	End	E-Value	Type
Pfam:Histone	54	169	3.7e-13	PFAM
RhoGEF	203	388	1.98e-35	SMART
PH	443	547	1.54e-14	SMART
RasGEFN	595	740	5.8e-52	SMART
RasGEF	775	1019	2.51e-92	SMART
low complexity region	1079	1099	N/A	INTRINSIC
low complexity region	1144	1152	N/A	INTRINSIC
low complexity region	1173	1192	N/A	INTRINSIC
low complexity region	1200	1225	N/A	INTRINSIC
low complexity region	1254	1269	N/A	INTRINSIC
low complexity region	1276	1292	N/A	INTRINSIC
low complexity region	1301	1309	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000182396
AA Change: Y881D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138589
Gene: ENSMUSG00000034801
AA Change: Y881D

Domain	Start	End	E-Value	Type
Pfam:Histone	97	169	1e-9	PFAM
Pfam:RhoGEF	203	344	1.6e-12	PFAM
PH	410	514	1.54e-14	SMART
RasGEFN	562	707	5.8e-52	SMART
RasGEF	742	986	2.51e-92	SMART
low complexity region	1046	1066	N/A	INTRINSIC
low complexity region	1111	1119	N/A	INTRINSIC
low complexity region	1140	1159	N/A	INTRINSIC
low complexity region	1167	1192	N/A	INTRINSIC
low complexity region	1221	1236	N/A	INTRINSIC
low complexity region	1243	1259	N/A	INTRINSIC
low complexity region	1268	1276	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000183277
AA Change: Y914D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138793
Gene: ENSMUSG00000034801
AA Change: Y914D

Domain	Start	End	E-Value	Type
Pfam:Histone	97	169	8.9e-11	PFAM
RhoGEF	203	388	1.98e-35	SMART
PH	443	547	1.54e-14	SMART
RasGEFN	595	740	5.8e-52	SMART
RasGEF	775	1019	2.51e-92	SMART
low complexity region	1079	1099	N/A	INTRINSIC
low complexity region	1144	1152	N/A	INTRINSIC
low complexity region	1173	1192	N/A	INTRINSIC
low complexity region	1200	1225	N/A	INTRINSIC
low complexity region	1254	1269	N/A	INTRINSIC
low complexity region	1276	1292	N/A	INTRINSIC
low complexity region	1301	1309	N/A	INTRINSIC

Meta Mutation Damage Score

0.9656

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulatory protein that is involved in the positive regulation of ras proteins. Mutations in this gene are associated with Noonan Syndrome-9. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal embryonic and adult histopathology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arid4a	T	A	12: 71,060,115	Y320*	probably null	Het
Ash1l	T	A	3: 89,052,755	C2265S	probably damaging	Het
Atg4b	T	A	1: 93,785,972	C55*	probably null	Het
Cacna1s	A	T	1: 136,077,692	N405I	probably benign	Het
Capn11	A	T	17: 45,633,399	D526E	probably damaging	Het
Ccdc188	A	G	16: 18,218,380	R71G	probably benign	Het
Ccser2	G	A	14: 36,896,263	R772W	probably damaging	Het
Cenpf	T	A	1: 189,682,403	E172D	probably benign	Het
Cep85	T	C	4: 134,134,089	M627V	probably null	Het
Chd1	G	A	17: 17,374,475		probably benign	Het
Cnst	A	G	1: 179,610,194	H441R	probably benign	Het
Cyp2d11	G	T	15: 82,390,437	T313N	probably damaging	Het
Cyp2g1	A	G	7: 26,814,734	N255S	possibly damaging	Het
Dnah5	A	G	15: 28,453,268	D4395G	probably damaging	Het
Fam83h	ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT	ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT	15: 76,002,775		probably benign	Het
Fcnb	C	T	2: 28,078,318	S209N	possibly damaging	Het
Gpsm1	CT	CTT	2: 26,327,352		probably null	Het
Lama4	A	G	10: 39,078,720	S1090G	probably damaging	Het
Malrd1	A	G	2: 15,925,120	D1479G	unknown	Het
Man2a2	T	C	7: 80,361,018	K742E	probably benign	Het
Mapk8	A	T	14: 33,382,284	S392T	probably benign	Het
Mark3	T	C	12: 111,592,683	I53T	probably damaging	Het
Mcmdc2	A	G	1: 9,916,642	I219V	probably benign	Het
Mlycd	A	T	8: 119,407,593	E278V	probably benign	Het
Muc2	G	T	7: 141,704,252	C29F		Het
Mup20	T	C	4: 62,053,484	I77V	probably benign	Het
Myh3	A	G	11: 67,092,002	E849G	probably damaging	Het
Nedd4	A	G	9: 72,686,107	N154S	probably damaging	Het
Olfr397	A	T	11: 73,965,414	I269F	probably benign	Het
Pcdh7	A	T	5: 57,720,336	N411I	probably damaging	Het
Plekhm1	A	G	11: 103,395,060	I183T	possibly damaging	Het
Prkar2a	G	A	9: 108,692,511	V19M	probably damaging	Het
Prss35	T	G	9: 86,755,613	N145K	possibly damaging	Het
Ranbp2	T	A	10: 58,455,925	D251E	possibly damaging	Het
Rnf169	C	A	7: 99,926,444	V315F	probably damaging	Het
Slc32a1	T	C	2: 158,613,841	Y139H	probably damaging	Het
Slc5a2	T	C	7: 128,271,156	V522A	probably benign	Het
Slc6a6	A	T	6: 91,740,971	Q297L	probably damaging	Het
Spata1	G	T	3: 146,489,859	T32N	possibly damaging	Het
Srcap	C	T	7: 127,539,197	R1180C	probably damaging	Het
St14	A	T	9: 31,131,625	M1K	probably null	Het
Tcaf1	T	C	6: 42,675,302	T749A	probably benign	Het
Tcp1	T	C	17: 12,922,734		probably null	Het
Tle6	A	G	10: 81,591,054	V576A	probably damaging	Het
Ttc25	G	A	11: 100,563,676	G429E	probably benign	Het
Usp17lc	T	A	7: 103,418,200	M234K	probably benign	Het
Washc4	A	G	10: 83,580,299	I818V	possibly damaging	Het
Zdhhc18	A	G	4: 133,613,854	L236P	probably damaging	Het
Zfp266	T	C	9: 20,500,314	D189G	probably benign	Het
Zfp474	A	T	18: 52,639,157	D294V	probably damaging	Het
Zfp568	T	C	7: 30,023,333	F568L	probably damaging	Het
Zfp93	A	G	7: 24,276,054	K488R	probably benign	Het

Other mutations in Sos2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01138:Sos2	APN	12	69616849	splice site	probably benign
IGL01348:Sos2	APN	12	69618092	missense	probably damaging	0.99
IGL01360:Sos2	APN	12	69590800	missense	probably benign	0.00
IGL01586:Sos2	APN	12	69607398	missense	probably damaging	1.00
IGL01721:Sos2	APN	12	69603867	missense	probably damaging	0.99
IGL02024:Sos2	APN	12	69618048	splice site	probably benign
IGL02347:Sos2	APN	12	69596746	missense	probably benign
IGL02419:Sos2	APN	12	69616990	missense	probably benign
IGL02684:Sos2	APN	12	69596666	missense	probably damaging	1.00
IGL02719:Sos2	APN	12	69617184	missense	probably benign	0.00
IGL03099:Sos2	APN	12	69616359	missense	probably damaging	1.00
Bechamel	UTSW	12	69603553	missense	probably damaging	1.00
sauce	UTSW	12	69596795	missense	probably damaging	1.00
G1citation:Sos2	UTSW	12	69650649	missense	probably damaging	1.00
PIT4131001:Sos2	UTSW	12	69618077	missense	probably benign
R0038:Sos2	UTSW	12	69596693	missense	probably damaging	1.00
R0233:Sos2	UTSW	12	69617330	missense	probably benign	0.00
R0233:Sos2	UTSW	12	69617330	missense	probably benign	0.00
R0326:Sos2	UTSW	12	69635685	missense	probably damaging	1.00
R1386:Sos2	UTSW	12	69614658	missense	probably damaging	1.00
R1472:Sos2	UTSW	12	69585316	splice site	probably null
R1534:Sos2	UTSW	12	69616955	missense	probably damaging	1.00
R1861:Sos2	UTSW	12	69617363	missense	probably damaging	1.00
R1934:Sos2	UTSW	12	69648541	missense	probably damaging	0.99
R1964:Sos2	UTSW	12	69616862	missense	possibly damaging	0.51
R2402:Sos2	UTSW	12	69596799	missense	possibly damaging	0.95
R2516:Sos2	UTSW	12	69650659	missense	probably damaging	0.99
R2571:Sos2	UTSW	12	69635718	missense	possibly damaging	0.95
R3423:Sos2	UTSW	12	69603553	missense	probably damaging	1.00
R4435:Sos2	UTSW	12	69614699	missense	possibly damaging	0.79
R4508:Sos2	UTSW	12	69635661	nonsense	probably null
R4595:Sos2	UTSW	12	69616889	missense	probably damaging	1.00
R4606:Sos2	UTSW	12	69614606	intron	probably benign
R4691:Sos2	UTSW	12	69616328	missense	probably damaging	1.00
R4716:Sos2	UTSW	12	69607371	missense	probably benign	0.04
R4863:Sos2	UTSW	12	69640154	missense	probably benign	0.04
R5179:Sos2	UTSW	12	69650728	nonsense	probably null
R5319:Sos2	UTSW	12	69627284	missense	probably benign	0.22
R5694:Sos2	UTSW	12	69590915	missense	probably damaging	0.96
R5877:Sos2	UTSW	12	69596795	missense	probably damaging	1.00
R6363:Sos2	UTSW	12	69632111	missense	probably benign	0.00
R6465:Sos2	UTSW	12	69596775	missense	probably benign	0.01
R6817:Sos2	UTSW	12	69618161	missense	probably benign	0.32
R6822:Sos2	UTSW	12	69650649	missense	probably damaging	1.00
R7015:Sos2	UTSW	12	69585235	missense	probably benign	0.43
R7562:Sos2	UTSW	12	69635638	missense	probably benign	0.12
R7570:Sos2	UTSW	12	69590880	missense	probably damaging	1.00
R7757:Sos2	UTSW	12	69648585	missense	probably damaging	0.99
R7975:Sos2	UTSW	12	69593040	missense	probably benign	0.20
R8079:Sos2	UTSW	12	69607215	missense	probably damaging	1.00
R8756:Sos2	UTSW	12	69648536	missense	probably damaging	1.00
R8775:Sos2	UTSW	12	69617232	missense	probably benign	0.02
R8775-TAIL:Sos2	UTSW	12	69617232	missense	probably benign	0.02
R9136:Sos2	UTSW	12	69586672	missense	possibly damaging	0.95
R9245:Sos2	UTSW	12	69648465	missense	probably damaging	1.00
Z1177:Sos2	UTSW	12	69585592	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACAAGACTTGTTAAGTAGTGCAG -3'
(R):5'- CTCATTTTAGCAAGTGTCCAAAGGAG -3'

Sequencing Primer
(F):5'- GACCTGGTCTCTTTTGGA -3'
(R):5'- CAAGTGTCCAAAGGAGTAAAACTC -3'

Posted On

2020-07-13