Incidental Mutation 'R8194:Sos2'
ID635363
Institutional Source Beutler Lab
Gene Symbol Sos2
Ensembl Gene ENSMUSG00000034801
Gene NameSOS Ras/Rho guanine nucleotide exchange factor 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8194 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location69583762-69681852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 69598824 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 914 (Y914D)
Ref Sequence ENSEMBL: ENSMUSP00000138793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035773] [ENSMUST00000182396] [ENSMUST00000183277]
PDB Structure
ORIENTATION OF PEPTIDE FRAGMENTS FROM SOS PROTEINS BOUND TO THE N-TERMINAL SH3 DOMAIN OF GRB2 DETERMINED BY NMR SPECTROSCOPY [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000035773
AA Change: Y913D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044866
Gene: ENSMUSG00000034801
AA Change: Y913D

DomainStartEndE-ValueType
Pfam:Histone 54 169 3.7e-13 PFAM
RhoGEF 203 388 1.98e-35 SMART
PH 443 547 1.54e-14 SMART
RasGEFN 595 740 5.8e-52 SMART
RasGEF 775 1019 2.51e-92 SMART
low complexity region 1079 1099 N/A INTRINSIC
low complexity region 1144 1152 N/A INTRINSIC
low complexity region 1173 1192 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
low complexity region 1254 1269 N/A INTRINSIC
low complexity region 1276 1292 N/A INTRINSIC
low complexity region 1301 1309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182396
AA Change: Y881D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138589
Gene: ENSMUSG00000034801
AA Change: Y881D

DomainStartEndE-ValueType
Pfam:Histone 97 169 1e-9 PFAM
Pfam:RhoGEF 203 344 1.6e-12 PFAM
PH 410 514 1.54e-14 SMART
RasGEFN 562 707 5.8e-52 SMART
RasGEF 742 986 2.51e-92 SMART
low complexity region 1046 1066 N/A INTRINSIC
low complexity region 1111 1119 N/A INTRINSIC
low complexity region 1140 1159 N/A INTRINSIC
low complexity region 1167 1192 N/A INTRINSIC
low complexity region 1221 1236 N/A INTRINSIC
low complexity region 1243 1259 N/A INTRINSIC
low complexity region 1268 1276 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183277
AA Change: Y914D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138793
Gene: ENSMUSG00000034801
AA Change: Y914D

DomainStartEndE-ValueType
Pfam:Histone 97 169 8.9e-11 PFAM
RhoGEF 203 388 1.98e-35 SMART
PH 443 547 1.54e-14 SMART
RasGEFN 595 740 5.8e-52 SMART
RasGEF 775 1019 2.51e-92 SMART
low complexity region 1079 1099 N/A INTRINSIC
low complexity region 1144 1152 N/A INTRINSIC
low complexity region 1173 1192 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
low complexity region 1254 1269 N/A INTRINSIC
low complexity region 1276 1292 N/A INTRINSIC
low complexity region 1301 1309 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulatory protein that is involved in the positive regulation of ras proteins. Mutations in this gene are associated with Noonan Syndrome-9. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal embryonic and adult histopathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230046K03Rik A G 10: 83,580,299 I818V possibly damaging Het
Arid4a T A 12: 71,060,115 Y320* probably null Het
Ash1l T A 3: 89,052,755 C2265S probably damaging Het
Atg4b T A 1: 93,785,972 C55* probably null Het
Cacna1s A T 1: 136,077,692 N405I probably benign Het
Capn11 A T 17: 45,633,399 D526E probably damaging Het
Ccdc188 A G 16: 18,218,380 R71G probably benign Het
Ccser2 G A 14: 36,896,263 R772W probably damaging Het
Cenpf T A 1: 189,682,403 E172D probably benign Het
Cep85 T C 4: 134,134,089 M627V probably null Het
Chd1 G A 17: 17,374,475 probably benign Het
Cnst A G 1: 179,610,194 H441R probably benign Het
Cyp2d11 G T 15: 82,390,437 T313N probably damaging Het
Cyp2g1 A G 7: 26,814,734 N255S possibly damaging Het
Dnah5 A G 15: 28,453,268 D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,327,352 probably null Het
Lama4 A G 10: 39,078,720 S1090G probably damaging Het
Malrd1 A G 2: 15,925,120 D1479G unknown Het
Man2a2 T C 7: 80,361,018 K742E probably benign Het
Mapk8 A T 14: 33,382,284 S392T probably benign Het
Mark3 T C 12: 111,592,683 I53T probably damaging Het
Mcmdc2 A G 1: 9,916,642 I219V probably benign Het
Mlycd A T 8: 119,407,593 E278V probably benign Het
Muc2 G T 7: 141,704,252 C29F Het
Mup20 T C 4: 62,053,484 I77V probably benign Het
Myh3 A G 11: 67,092,002 E849G probably damaging Het
Nedd4 A G 9: 72,686,107 N154S probably damaging Het
Olfr397 A T 11: 73,965,414 I269F probably benign Het
Pcdh7 A T 5: 57,720,336 N411I probably damaging Het
Plekhm1 A G 11: 103,395,060 I183T possibly damaging Het
Prkar2a G A 9: 108,692,511 V19M probably damaging Het
Prss35 T G 9: 86,755,613 N145K possibly damaging Het
Ranbp2 T A 10: 58,455,925 D251E possibly damaging Het
Rnf169 C A 7: 99,926,444 V315F probably damaging Het
Slc32a1 T C 2: 158,613,841 Y139H probably damaging Het
Slc5a2 T C 7: 128,271,156 V522A probably benign Het
Slc6a6 A T 6: 91,740,971 Q297L probably damaging Het
Spata1 G T 3: 146,489,859 T32N possibly damaging Het
Srcap C T 7: 127,539,197 R1180C probably damaging Het
St14 A T 9: 31,131,625 M1K probably null Het
Tcaf1 T C 6: 42,675,302 T749A probably benign Het
Tcp1 T C 17: 12,922,734 probably null Het
Tle6 A G 10: 81,591,054 V576A probably damaging Het
Ttc25 G A 11: 100,563,676 G429E probably benign Het
Usp17lc T A 7: 103,418,200 M234K probably benign Het
Zdhhc18 A G 4: 133,613,854 L236P probably damaging Het
Zfp266 T C 9: 20,500,314 D189G probably benign Het
Zfp474 A T 18: 52,639,157 D294V probably damaging Het
Zfp568 T C 7: 30,023,333 F568L probably damaging Het
Zfp93 A G 7: 24,276,054 K488R probably benign Het
Other mutations in Sos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Sos2 APN 12 69616849 splice site probably benign
IGL01348:Sos2 APN 12 69618092 missense probably damaging 0.99
IGL01360:Sos2 APN 12 69590800 missense probably benign 0.00
IGL01586:Sos2 APN 12 69607398 missense probably damaging 1.00
IGL01721:Sos2 APN 12 69603867 missense probably damaging 0.99
IGL02024:Sos2 APN 12 69618048 splice site probably benign
IGL02347:Sos2 APN 12 69596746 missense probably benign
IGL02419:Sos2 APN 12 69616990 missense probably benign
IGL02684:Sos2 APN 12 69596666 missense probably damaging 1.00
IGL02719:Sos2 APN 12 69617184 missense probably benign 0.00
IGL03099:Sos2 APN 12 69616359 missense probably damaging 1.00
Bechamel UTSW 12 69603553 missense probably damaging 1.00
sauce UTSW 12 69596795 missense probably damaging 1.00
PIT4131001:Sos2 UTSW 12 69618077 missense probably benign
R0038:Sos2 UTSW 12 69596693 missense probably damaging 1.00
R0233:Sos2 UTSW 12 69617330 missense probably benign 0.00
R0233:Sos2 UTSW 12 69617330 missense probably benign 0.00
R0326:Sos2 UTSW 12 69635685 missense probably damaging 1.00
R1386:Sos2 UTSW 12 69614658 missense probably damaging 1.00
R1472:Sos2 UTSW 12 69585316 splice site probably null
R1534:Sos2 UTSW 12 69616955 missense probably damaging 1.00
R1861:Sos2 UTSW 12 69617363 missense probably damaging 1.00
R1934:Sos2 UTSW 12 69648541 missense probably damaging 0.99
R1964:Sos2 UTSW 12 69616862 missense possibly damaging 0.51
R2402:Sos2 UTSW 12 69596799 missense possibly damaging 0.95
R2516:Sos2 UTSW 12 69650659 missense probably damaging 0.99
R2571:Sos2 UTSW 12 69635718 missense possibly damaging 0.95
R3423:Sos2 UTSW 12 69603553 missense probably damaging 1.00
R4435:Sos2 UTSW 12 69614699 missense possibly damaging 0.79
R4508:Sos2 UTSW 12 69635661 nonsense probably null
R4595:Sos2 UTSW 12 69616889 missense probably damaging 1.00
R4606:Sos2 UTSW 12 69614606 intron probably benign
R4691:Sos2 UTSW 12 69616328 missense probably damaging 1.00
R4716:Sos2 UTSW 12 69607371 missense probably benign 0.04
R4863:Sos2 UTSW 12 69640154 missense probably benign 0.04
R5179:Sos2 UTSW 12 69650728 nonsense probably null
R5319:Sos2 UTSW 12 69627284 missense probably benign 0.22
R5694:Sos2 UTSW 12 69590915 missense probably damaging 0.96
R5877:Sos2 UTSW 12 69596795 missense probably damaging 1.00
R6363:Sos2 UTSW 12 69632111 missense probably benign 0.00
R6465:Sos2 UTSW 12 69596775 missense probably benign 0.01
R6817:Sos2 UTSW 12 69618161 missense probably benign 0.32
R6822:Sos2 UTSW 12 69650649 missense probably damaging 1.00
R7015:Sos2 UTSW 12 69585235 missense probably benign 0.43
R7562:Sos2 UTSW 12 69635638 missense probably benign 0.12
R7570:Sos2 UTSW 12 69590880 missense probably damaging 1.00
R7757:Sos2 UTSW 12 69648585 missense probably damaging 0.99
R7975:Sos2 UTSW 12 69593040 missense probably benign 0.20
R8079:Sos2 UTSW 12 69607215 missense probably damaging 1.00
Z1177:Sos2 UTSW 12 69585592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAAGACTTGTTAAGTAGTGCAG -3'
(R):5'- CTCATTTTAGCAAGTGTCCAAAGGAG -3'

Sequencing Primer
(F):5'- GACCTGGTCTCTTTTGGA -3'
(R):5'- CAAGTGTCCAAAGGAGTAAAACTC -3'
Posted On2020-07-13