Incidental Mutation 'R8194:Mark3'
ID635365
Institutional Source Beutler Lab
Gene Symbol Mark3
Ensembl Gene ENSMUSG00000007411
Gene NameMAP/microtubule affinity regulating kinase 3
SynonymsA430080F22Rik, ETK-1, C-TAK1, 1600015G02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R8194 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location111574523-111656221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111592683 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 53 (I53T)
Ref Sequence ENSEMBL: ENSMUSP00000082017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075281] [ENSMUST00000084953]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075281
AA Change: I53T

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074757
Gene: ENSMUSG00000007411
AA Change: I53T

DomainStartEndE-ValueType
S_TKc 56 307 7.4e-109 SMART
UBA 328 365 6.91e-9 SMART
low complexity region 368 385 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
Pfam:KA1 683 729 3.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084953
AA Change: I53T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082017
Gene: ENSMUSG00000007411
AA Change: I53T

DomainStartEndE-ValueType
S_TKc 56 307 7.4e-109 SMART
UBA 328 365 6.91e-9 SMART
low complexity region 368 385 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
Pfam:KA1 700 744 4e-23 PFAM
Meta Mutation Damage Score 0.5245 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is activated by phosphorylation and in turn is involved in the phosphorylation of tau proteins MAP2 and MAP4. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous disruption of this gene results in decreased body weight, increased energy expenditure, reduced adiposity, and protection from high-fat diet induced obesity. On a high-fat diet, mice show resistance to hepatic steatosis, improved glucose tolerance, and decreased insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230046K03Rik A G 10: 83,580,299 I818V possibly damaging Het
Arid4a T A 12: 71,060,115 Y320* probably null Het
Ash1l T A 3: 89,052,755 C2265S probably damaging Het
Atg4b T A 1: 93,785,972 C55* probably null Het
Cacna1s A T 1: 136,077,692 N405I probably benign Het
Capn11 A T 17: 45,633,399 D526E probably damaging Het
Ccdc188 A G 16: 18,218,380 R71G probably benign Het
Ccser2 G A 14: 36,896,263 R772W probably damaging Het
Cenpf T A 1: 189,682,403 E172D probably benign Het
Cep85 T C 4: 134,134,089 M627V probably null Het
Chd1 G A 17: 17,374,475 probably benign Het
Cnst A G 1: 179,610,194 H441R probably benign Het
Cyp2d11 G T 15: 82,390,437 T313N probably damaging Het
Cyp2g1 A G 7: 26,814,734 N255S possibly damaging Het
Dnah5 A G 15: 28,453,268 D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,327,352 probably null Het
Lama4 A G 10: 39,078,720 S1090G probably damaging Het
Malrd1 A G 2: 15,925,120 D1479G unknown Het
Man2a2 T C 7: 80,361,018 K742E probably benign Het
Mapk8 A T 14: 33,382,284 S392T probably benign Het
Mcmdc2 A G 1: 9,916,642 I219V probably benign Het
Mlycd A T 8: 119,407,593 E278V probably benign Het
Muc2 G T 7: 141,704,252 C29F Het
Mup20 T C 4: 62,053,484 I77V probably benign Het
Myh3 A G 11: 67,092,002 E849G probably damaging Het
Nedd4 A G 9: 72,686,107 N154S probably damaging Het
Olfr397 A T 11: 73,965,414 I269F probably benign Het
Pcdh7 A T 5: 57,720,336 N411I probably damaging Het
Plekhm1 A G 11: 103,395,060 I183T possibly damaging Het
Prkar2a G A 9: 108,692,511 V19M probably damaging Het
Prss35 T G 9: 86,755,613 N145K possibly damaging Het
Ranbp2 T A 10: 58,455,925 D251E possibly damaging Het
Rnf169 C A 7: 99,926,444 V315F probably damaging Het
Slc32a1 T C 2: 158,613,841 Y139H probably damaging Het
Slc5a2 T C 7: 128,271,156 V522A probably benign Het
Slc6a6 A T 6: 91,740,971 Q297L probably damaging Het
Sos2 A C 12: 69,598,824 Y914D probably damaging Het
Spata1 G T 3: 146,489,859 T32N possibly damaging Het
Srcap C T 7: 127,539,197 R1180C probably damaging Het
St14 A T 9: 31,131,625 M1K probably null Het
Tcaf1 T C 6: 42,675,302 T749A probably benign Het
Tcp1 T C 17: 12,922,734 probably null Het
Tle6 A G 10: 81,591,054 V576A probably damaging Het
Ttc25 G A 11: 100,563,676 G429E probably benign Het
Usp17lc T A 7: 103,418,200 M234K probably benign Het
Zdhhc18 A G 4: 133,613,854 L236P probably damaging Het
Zfp266 T C 9: 20,500,314 D189G probably benign Het
Zfp474 A T 18: 52,639,157 D294V probably damaging Het
Zfp568 T C 7: 30,023,333 F568L probably damaging Het
Zfp93 A G 7: 24,276,054 K488R probably benign Het
Other mutations in Mark3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Mark3 APN 12 111627522 missense probably damaging 0.99
IGL02047:Mark3 APN 12 111618363 missense probably damaging 1.00
IGL02345:Mark3 APN 12 111627107 missense probably damaging 0.99
IGL02637:Mark3 APN 12 111592656 missense probably damaging 0.98
IGL03310:Mark3 APN 12 111647670 missense probably benign
IGL03349:Mark3 APN 12 111628250 missense probably benign 0.19
R0377:Mark3 UTSW 12 111629029 missense probably damaging 0.96
R0551:Mark3 UTSW 12 111633634 missense probably benign
R0846:Mark3 UTSW 12 111627224 missense possibly damaging 0.85
R1104:Mark3 UTSW 12 111618397 splice site probably benign
R1305:Mark3 UTSW 12 111615446 critical splice donor site probably null
R1344:Mark3 UTSW 12 111627837 missense possibly damaging 0.94
R1418:Mark3 UTSW 12 111627837 missense possibly damaging 0.94
R1434:Mark3 UTSW 12 111623325 splice site probably benign
R1556:Mark3 UTSW 12 111627841 missense probably damaging 0.98
R1569:Mark3 UTSW 12 111633746 missense probably benign 0.01
R1582:Mark3 UTSW 12 111655310 missense probably benign 0.12
R1936:Mark3 UTSW 12 111618365 missense probably damaging 0.99
R1975:Mark3 UTSW 12 111615441 missense probably damaging 1.00
R2507:Mark3 UTSW 12 111627242 missense probably damaging 1.00
R4394:Mark3 UTSW 12 111604523 missense possibly damaging 0.91
R4912:Mark3 UTSW 12 111592653 missense probably benign 0.42
R4926:Mark3 UTSW 12 111618324 nonsense probably null
R5060:Mark3 UTSW 12 111618326 missense probably damaging 0.98
R5133:Mark3 UTSW 12 111655328 missense probably damaging 1.00
R5813:Mark3 UTSW 12 111655443 missense probably damaging 1.00
R5834:Mark3 UTSW 12 111624487 missense probably damaging 0.99
R5926:Mark3 UTSW 12 111592734 missense probably damaging 1.00
R6523:Mark3 UTSW 12 111627235 missense probably damaging 1.00
R6663:Mark3 UTSW 12 111575083 missense probably benign 0.42
R6719:Mark3 UTSW 12 111615442 missense probably damaging 1.00
R6942:Mark3 UTSW 12 111592654 missense probably null 0.02
R6966:Mark3 UTSW 12 111640024 missense probably damaging 0.96
R6978:Mark3 UTSW 12 111627148 missense probably benign
R7303:Mark3 UTSW 12 111655536 missense probably damaging 1.00
R7408:Mark3 UTSW 12 111633789 missense probably damaging 0.99
R7454:Mark3 UTSW 12 111604527 missense probably damaging 1.00
R7680:Mark3 UTSW 12 111646773 missense probably benign 0.01
R8243:Mark3 UTSW 12 111647522 missense possibly damaging 0.73
R8385:Mark3 UTSW 12 111655374 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AGATGCTCCTAAAATTTGGCAG -3'
(R):5'- AAGTTGGCTCATTCCCTTGGTG -3'

Sequencing Primer
(F):5'- GCTCCTAAAATTTGGCAGTACTG -3'
(R):5'- CTAACGATGTCCTGGTCCTTAAGAG -3'
Posted On2020-07-13