Incidental Mutation 'R8194:Mark3'
ID 635365
Institutional Source Beutler Lab
Gene Symbol Mark3
Ensembl Gene ENSMUSG00000007411
Gene Name MAP/microtubule affinity regulating kinase 3
Synonyms 1600015G02Rik, C-TAK1, ETK-1, A430080F22Rik
MMRRC Submission 067617-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.185) question?
Stock # R8194 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 111540957-111622655 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 111559117 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 53 (I53T)
Ref Sequence ENSEMBL: ENSMUSP00000082017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075281] [ENSMUST00000084953]
AlphaFold Q03141
Predicted Effect possibly damaging
Transcript: ENSMUST00000075281
AA Change: I53T

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074757
Gene: ENSMUSG00000007411
AA Change: I53T

DomainStartEndE-ValueType
S_TKc 56 307 7.4e-109 SMART
UBA 328 365 6.91e-9 SMART
low complexity region 368 385 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
Pfam:KA1 683 729 3.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084953
AA Change: I53T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082017
Gene: ENSMUSG00000007411
AA Change: I53T

DomainStartEndE-ValueType
S_TKc 56 307 7.4e-109 SMART
UBA 328 365 6.91e-9 SMART
low complexity region 368 385 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
Pfam:KA1 700 744 4e-23 PFAM
Meta Mutation Damage Score 0.5245 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is activated by phosphorylation and in turn is involved in the phosphorylation of tau proteins MAP2 and MAP4. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous disruption of this gene results in decreased body weight, increased energy expenditure, reduced adiposity, and protection from high-fat diet induced obesity. On a high-fat diet, mice show resistance to hepatic steatosis, improved glucose tolerance, and decreased insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4a T A 12: 71,106,889 (GRCm39) Y320* probably null Het
Ash1l T A 3: 88,960,062 (GRCm39) C2265S probably damaging Het
Atg4b T A 1: 93,713,694 (GRCm39) C55* probably null Het
Cacna1s A T 1: 136,005,430 (GRCm39) N405I probably benign Het
Capn11 A T 17: 45,944,325 (GRCm39) D526E probably damaging Het
Ccdc188 A G 16: 18,036,244 (GRCm39) R71G probably benign Het
Ccser2 G A 14: 36,618,220 (GRCm39) R772W probably damaging Het
Cenpf T A 1: 189,414,600 (GRCm39) E172D probably benign Het
Cep85 T C 4: 133,861,400 (GRCm39) M627V probably null Het
Chd1 G A 17: 17,594,737 (GRCm39) probably benign Het
Cnst A G 1: 179,437,759 (GRCm39) H441R probably benign Het
Cyp2d11 G T 15: 82,274,638 (GRCm39) T313N probably damaging Het
Cyp2g1 A G 7: 26,514,159 (GRCm39) N255S possibly damaging Het
Dnah5 A G 15: 28,453,414 (GRCm39) D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 75,874,624 (GRCm39) probably benign Het
Fcnb C T 2: 27,968,330 (GRCm39) S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,217,364 (GRCm39) probably null Het
Lama4 A G 10: 38,954,716 (GRCm39) S1090G probably damaging Het
Malrd1 A G 2: 15,929,931 (GRCm39) D1479G unknown Het
Man2a2 T C 7: 80,010,766 (GRCm39) K742E probably benign Het
Mapk8 A T 14: 33,104,241 (GRCm39) S392T probably benign Het
Mcmdc2 A G 1: 9,986,867 (GRCm39) I219V probably benign Het
Mlycd A T 8: 120,134,332 (GRCm39) E278V probably benign Het
Muc2 G T 7: 141,290,801 (GRCm39) C29F Het
Mup20 T C 4: 61,971,721 (GRCm39) I77V probably benign Het
Myh3 A G 11: 66,982,828 (GRCm39) E849G probably damaging Het
Nedd4 A G 9: 72,593,389 (GRCm39) N154S probably damaging Het
Odad4 G A 11: 100,454,502 (GRCm39) G429E probably benign Het
Or1e1f A T 11: 73,856,240 (GRCm39) I269F probably benign Het
Pcdh7 A T 5: 57,877,678 (GRCm39) N411I probably damaging Het
Plekhm1 A G 11: 103,285,886 (GRCm39) I183T possibly damaging Het
Prkar2a G A 9: 108,569,710 (GRCm39) V19M probably damaging Het
Prss35 T G 9: 86,637,666 (GRCm39) N145K possibly damaging Het
Ranbp2 T A 10: 58,291,747 (GRCm39) D251E possibly damaging Het
Rnf169 C A 7: 99,575,651 (GRCm39) V315F probably damaging Het
Slc32a1 T C 2: 158,455,761 (GRCm39) Y139H probably damaging Het
Slc5a2 T C 7: 127,870,328 (GRCm39) V522A probably benign Het
Slc6a6 A T 6: 91,717,952 (GRCm39) Q297L probably damaging Het
Sos2 A C 12: 69,645,598 (GRCm39) Y914D probably damaging Het
Spata1 G T 3: 146,195,614 (GRCm39) T32N possibly damaging Het
Srcap C T 7: 127,138,369 (GRCm39) R1180C probably damaging Het
St14 A T 9: 31,042,921 (GRCm39) M1K probably null Het
Tcaf1 T C 6: 42,652,236 (GRCm39) T749A probably benign Het
Tcp1 T C 17: 13,141,621 (GRCm39) probably null Het
Tle6 A G 10: 81,426,888 (GRCm39) V576A probably damaging Het
Usp17lc T A 7: 103,067,407 (GRCm39) M234K probably benign Het
Washc4 A G 10: 83,416,163 (GRCm39) I818V possibly damaging Het
Zdhhc18 A G 4: 133,341,165 (GRCm39) L236P probably damaging Het
Zfp266 T C 9: 20,411,610 (GRCm39) D189G probably benign Het
Zfp474 A T 18: 52,772,229 (GRCm39) D294V probably damaging Het
Zfp568 T C 7: 29,722,758 (GRCm39) F568L probably damaging Het
Zfp93 A G 7: 23,975,479 (GRCm39) K488R probably benign Het
Other mutations in Mark3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Mark3 APN 12 111,593,956 (GRCm39) missense probably damaging 0.99
IGL02047:Mark3 APN 12 111,584,797 (GRCm39) missense probably damaging 1.00
IGL02345:Mark3 APN 12 111,593,541 (GRCm39) missense probably damaging 0.99
IGL02637:Mark3 APN 12 111,559,090 (GRCm39) missense probably damaging 0.98
IGL03310:Mark3 APN 12 111,614,104 (GRCm39) missense probably benign
IGL03349:Mark3 APN 12 111,594,684 (GRCm39) missense probably benign 0.19
R0377:Mark3 UTSW 12 111,595,463 (GRCm39) missense probably damaging 0.96
R0551:Mark3 UTSW 12 111,600,068 (GRCm39) missense probably benign
R0846:Mark3 UTSW 12 111,593,658 (GRCm39) missense possibly damaging 0.85
R1104:Mark3 UTSW 12 111,584,831 (GRCm39) splice site probably benign
R1305:Mark3 UTSW 12 111,581,880 (GRCm39) critical splice donor site probably null
R1344:Mark3 UTSW 12 111,594,271 (GRCm39) missense possibly damaging 0.94
R1418:Mark3 UTSW 12 111,594,271 (GRCm39) missense possibly damaging 0.94
R1434:Mark3 UTSW 12 111,589,759 (GRCm39) splice site probably benign
R1556:Mark3 UTSW 12 111,594,275 (GRCm39) missense probably damaging 0.98
R1569:Mark3 UTSW 12 111,600,180 (GRCm39) missense probably benign 0.01
R1582:Mark3 UTSW 12 111,621,744 (GRCm39) missense probably benign 0.12
R1936:Mark3 UTSW 12 111,584,799 (GRCm39) missense probably damaging 0.99
R1975:Mark3 UTSW 12 111,581,875 (GRCm39) missense probably damaging 1.00
R2507:Mark3 UTSW 12 111,593,676 (GRCm39) missense probably damaging 1.00
R4394:Mark3 UTSW 12 111,570,957 (GRCm39) missense possibly damaging 0.91
R4912:Mark3 UTSW 12 111,559,087 (GRCm39) missense probably benign 0.42
R4926:Mark3 UTSW 12 111,584,758 (GRCm39) nonsense probably null
R5060:Mark3 UTSW 12 111,584,760 (GRCm39) missense probably damaging 0.98
R5133:Mark3 UTSW 12 111,621,762 (GRCm39) missense probably damaging 1.00
R5813:Mark3 UTSW 12 111,621,877 (GRCm39) missense probably damaging 1.00
R5834:Mark3 UTSW 12 111,590,921 (GRCm39) missense probably damaging 0.99
R5926:Mark3 UTSW 12 111,559,168 (GRCm39) missense probably damaging 1.00
R6523:Mark3 UTSW 12 111,593,669 (GRCm39) missense probably damaging 1.00
R6663:Mark3 UTSW 12 111,541,517 (GRCm39) missense probably benign 0.42
R6719:Mark3 UTSW 12 111,581,876 (GRCm39) missense probably damaging 1.00
R6942:Mark3 UTSW 12 111,559,088 (GRCm39) missense probably null 0.02
R6966:Mark3 UTSW 12 111,606,458 (GRCm39) missense probably damaging 0.96
R6978:Mark3 UTSW 12 111,593,582 (GRCm39) missense probably benign
R7303:Mark3 UTSW 12 111,621,970 (GRCm39) missense probably damaging 1.00
R7408:Mark3 UTSW 12 111,600,223 (GRCm39) missense probably damaging 0.99
R7454:Mark3 UTSW 12 111,570,961 (GRCm39) missense probably damaging 1.00
R7680:Mark3 UTSW 12 111,613,207 (GRCm39) missense probably benign 0.01
R8243:Mark3 UTSW 12 111,613,956 (GRCm39) missense possibly damaging 0.73
R8385:Mark3 UTSW 12 111,621,808 (GRCm39) missense possibly damaging 0.68
R8788:Mark3 UTSW 12 111,613,124 (GRCm39) missense probably benign 0.00
R9144:Mark3 UTSW 12 111,606,376 (GRCm39) missense probably benign
R9562:Mark3 UTSW 12 111,570,960 (GRCm39) missense probably damaging 0.99
R9565:Mark3 UTSW 12 111,570,960 (GRCm39) missense probably damaging 0.99
R9735:Mark3 UTSW 12 111,621,882 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGATGCTCCTAAAATTTGGCAG -3'
(R):5'- AAGTTGGCTCATTCCCTTGGTG -3'

Sequencing Primer
(F):5'- GCTCCTAAAATTTGGCAGTACTG -3'
(R):5'- CTAACGATGTCCTGGTCCTTAAGAG -3'
Posted On 2020-07-13