Incidental Mutation 'R8194:Mapk8'
ID635366
Institutional Source Beutler Lab
Gene Symbol Mapk8
Ensembl Gene ENSMUSG00000021936
Gene Namemitogen-activated protein kinase 8
SynonymsJNK1, c-Jun N-terminal kinase, Prkm8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.766) question?
Stock #R8194 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location33377898-33447158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33382284 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 392 (S392T)
Ref Sequence ENSEMBL: ENSMUSP00000022504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022504] [ENSMUST00000111942] [ENSMUST00000111943] [ENSMUST00000111944] [ENSMUST00000111945]
Predicted Effect probably benign
Transcript: ENSMUST00000022504
AA Change: S392T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022504
Gene: ENSMUSG00000021936
AA Change: S392T

DomainStartEndE-ValueType
S_TKc 26 321 1.3e-86 SMART
low complexity region 390 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111942
SMART Domains Protein: ENSMUSP00000107573
Gene: ENSMUSG00000021936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 26 208 1.8e-25 PFAM
Pfam:Pkinase 26 210 5.2e-48 PFAM
Pfam:Kdo 33 178 6.4e-9 PFAM
SCOP:d1pme__ 216 286 2e-17 SMART
PDB:3GP0|A 218 288 4e-11 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000111943
SMART Domains Protein: ENSMUSP00000107574
Gene: ENSMUSG00000021936

DomainStartEndE-ValueType
S_TKc 26 321 1.3e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111944
AA Change: S392T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107575
Gene: ENSMUSG00000021936
AA Change: S392T

DomainStartEndE-ValueType
S_TKc 26 321 1.06e-86 SMART
low complexity region 390 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111945
SMART Domains Protein: ENSMUSP00000107576
Gene: ENSMUSG00000021936

DomainStartEndE-ValueType
S_TKc 26 321 1.06e-86 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is activated by various cell stimuli, and targets specific transcription factors, and thus mediates immediate-early gene expression in response to cell stimuli. The activation of this kinase by tumor-necrosis factor alpha (TNF-alpha) is found to be required for TNF-alpha induced apoptosis. This kinase is also involved in UV radiation induced apoptosis, which is thought to be related to cytochrom c-mediated cell death pathway. Studies of the mouse counterpart of this gene suggested that this kinase play a key role in T cell proliferation, apoptosis and differentiation. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal T cell differentiation and proliferation, cardiac morphology and physiology, and chemically-induced tumorigenesis. Mice homozygous for another knock-out allele exhibit abnormal glucose homeostasis and T cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230046K03Rik A G 10: 83,580,299 I818V possibly damaging Het
Arid4a T A 12: 71,060,115 Y320* probably null Het
Ash1l T A 3: 89,052,755 C2265S probably damaging Het
Atg4b T A 1: 93,785,972 C55* probably null Het
Cacna1s A T 1: 136,077,692 N405I probably benign Het
Capn11 A T 17: 45,633,399 D526E probably damaging Het
Ccdc188 A G 16: 18,218,380 R71G probably benign Het
Ccser2 G A 14: 36,896,263 R772W probably damaging Het
Cenpf T A 1: 189,682,403 E172D probably benign Het
Cep85 T C 4: 134,134,089 M627V probably null Het
Chd1 G A 17: 17,374,475 probably benign Het
Cnst A G 1: 179,610,194 H441R probably benign Het
Cyp2d11 G T 15: 82,390,437 T313N probably damaging Het
Cyp2g1 A G 7: 26,814,734 N255S possibly damaging Het
Dnah5 A G 15: 28,453,268 D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,327,352 probably null Het
Lama4 A G 10: 39,078,720 S1090G probably damaging Het
Malrd1 A G 2: 15,925,120 D1479G unknown Het
Man2a2 T C 7: 80,361,018 K742E probably benign Het
Mark3 T C 12: 111,592,683 I53T probably damaging Het
Mcmdc2 A G 1: 9,916,642 I219V probably benign Het
Mlycd A T 8: 119,407,593 E278V probably benign Het
Muc2 G T 7: 141,704,252 C29F Het
Mup20 T C 4: 62,053,484 I77V probably benign Het
Myh3 A G 11: 67,092,002 E849G probably damaging Het
Nedd4 A G 9: 72,686,107 N154S probably damaging Het
Olfr397 A T 11: 73,965,414 I269F probably benign Het
Pcdh7 A T 5: 57,720,336 N411I probably damaging Het
Plekhm1 A G 11: 103,395,060 I183T possibly damaging Het
Prkar2a G A 9: 108,692,511 V19M probably damaging Het
Prss35 T G 9: 86,755,613 N145K possibly damaging Het
Ranbp2 T A 10: 58,455,925 D251E possibly damaging Het
Rnf169 C A 7: 99,926,444 V315F probably damaging Het
Slc32a1 T C 2: 158,613,841 Y139H probably damaging Het
Slc5a2 T C 7: 128,271,156 V522A probably benign Het
Slc6a6 A T 6: 91,740,971 Q297L probably damaging Het
Sos2 A C 12: 69,598,824 Y914D probably damaging Het
Spata1 G T 3: 146,489,859 T32N possibly damaging Het
Srcap C T 7: 127,539,197 R1180C probably damaging Het
St14 A T 9: 31,131,625 M1K probably null Het
Tcaf1 T C 6: 42,675,302 T749A probably benign Het
Tcp1 T C 17: 12,922,734 probably null Het
Tle6 A G 10: 81,591,054 V576A probably damaging Het
Ttc25 G A 11: 100,563,676 G429E probably benign Het
Usp17lc T A 7: 103,418,200 M234K probably benign Het
Zdhhc18 A G 4: 133,613,854 L236P probably damaging Het
Zfp266 T C 9: 20,500,314 D189G probably benign Het
Zfp474 A T 18: 52,639,157 D294V probably damaging Het
Zfp568 T C 7: 30,023,333 F568L probably damaging Het
Zfp93 A G 7: 24,276,054 K488R probably benign Het
Other mutations in Mapk8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Mapk8 APN 14 33383900 missense probably benign 0.01
R0255:Mapk8 UTSW 14 33387307 splice site probably benign
R0401:Mapk8 UTSW 14 33382208 missense probably benign 0.37
R0862:Mapk8 UTSW 14 33392992 missense probably damaging 0.98
R0864:Mapk8 UTSW 14 33392992 missense probably damaging 0.98
R1084:Mapk8 UTSW 14 33388803 nonsense probably null
R1637:Mapk8 UTSW 14 33410962 missense probably benign 0.00
R2038:Mapk8 UTSW 14 33388936 nonsense probably null
R3959:Mapk8 UTSW 14 33382253 missense probably null 0.21
R4087:Mapk8 UTSW 14 33390248 missense probably benign 0.00
R4181:Mapk8 UTSW 14 33382220 missense probably damaging 1.00
R4183:Mapk8 UTSW 14 33382220 missense probably damaging 1.00
R4184:Mapk8 UTSW 14 33382220 missense probably damaging 1.00
R5366:Mapk8 UTSW 14 33390729 missense probably damaging 1.00
R6076:Mapk8 UTSW 14 33390293 missense probably damaging 1.00
R6991:Mapk8 UTSW 14 33410884 missense possibly damaging 0.82
R7345:Mapk8 UTSW 14 33408111 missense probably damaging 0.99
R7814:Mapk8 UTSW 14 33410877 nonsense probably null
Z1176:Mapk8 UTSW 14 33410886 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGTCACCACATAATAGTTGCTTTG -3'
(R):5'- AGTGCTGGGTTCAATACGATTC -3'

Sequencing Primer
(F):5'- GACCACTGAATTGTTTTTAAAGCAG -3'
(R):5'- GCTGGGTTCAATACGATTCAGCAAC -3'
Posted On2020-07-13