Incidental Mutation 'R8194:Mapk8'
ID 635366
Institutional Source Beutler Lab
Gene Symbol Mapk8
Ensembl Gene ENSMUSG00000021936
Gene Name mitogen-activated protein kinase 8
Synonyms c-Jun N-terminal kinase, Prkm8, JNK1
MMRRC Submission 067617-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.743) question?
Stock # R8194 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 33099855-33169115 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 33104241 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 392 (S392T)
Ref Sequence ENSEMBL: ENSMUSP00000022504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022504] [ENSMUST00000111942] [ENSMUST00000111943] [ENSMUST00000111944] [ENSMUST00000111945]
AlphaFold Q91Y86
Predicted Effect probably benign
Transcript: ENSMUST00000022504
AA Change: S392T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022504
Gene: ENSMUSG00000021936
AA Change: S392T

DomainStartEndE-ValueType
S_TKc 26 321 1.3e-86 SMART
low complexity region 390 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111942
SMART Domains Protein: ENSMUSP00000107573
Gene: ENSMUSG00000021936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 26 208 1.8e-25 PFAM
Pfam:Pkinase 26 210 5.2e-48 PFAM
Pfam:Kdo 33 178 6.4e-9 PFAM
SCOP:d1pme__ 216 286 2e-17 SMART
PDB:3GP0|A 218 288 4e-11 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000111943
SMART Domains Protein: ENSMUSP00000107574
Gene: ENSMUSG00000021936

DomainStartEndE-ValueType
S_TKc 26 321 1.3e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111944
AA Change: S392T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107575
Gene: ENSMUSG00000021936
AA Change: S392T

DomainStartEndE-ValueType
S_TKc 26 321 1.06e-86 SMART
low complexity region 390 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111945
SMART Domains Protein: ENSMUSP00000107576
Gene: ENSMUSG00000021936

DomainStartEndE-ValueType
S_TKc 26 321 1.06e-86 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is activated by various cell stimuli, and targets specific transcription factors, and thus mediates immediate-early gene expression in response to cell stimuli. The activation of this kinase by tumor-necrosis factor alpha (TNF-alpha) is found to be required for TNF-alpha induced apoptosis. This kinase is also involved in UV radiation induced apoptosis, which is thought to be related to cytochrom c-mediated cell death pathway. Studies of the mouse counterpart of this gene suggested that this kinase play a key role in T cell proliferation, apoptosis and differentiation. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal T cell differentiation and proliferation, cardiac morphology and physiology, and chemically-induced tumorigenesis. Mice homozygous for another knock-out allele exhibit abnormal glucose homeostasis and T cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4a T A 12: 71,106,889 (GRCm39) Y320* probably null Het
Ash1l T A 3: 88,960,062 (GRCm39) C2265S probably damaging Het
Atg4b T A 1: 93,713,694 (GRCm39) C55* probably null Het
Cacna1s A T 1: 136,005,430 (GRCm39) N405I probably benign Het
Capn11 A T 17: 45,944,325 (GRCm39) D526E probably damaging Het
Ccdc188 A G 16: 18,036,244 (GRCm39) R71G probably benign Het
Ccser2 G A 14: 36,618,220 (GRCm39) R772W probably damaging Het
Cenpf T A 1: 189,414,600 (GRCm39) E172D probably benign Het
Cep85 T C 4: 133,861,400 (GRCm39) M627V probably null Het
Chd1 G A 17: 17,594,737 (GRCm39) probably benign Het
Cnst A G 1: 179,437,759 (GRCm39) H441R probably benign Het
Cyp2d11 G T 15: 82,274,638 (GRCm39) T313N probably damaging Het
Cyp2g1 A G 7: 26,514,159 (GRCm39) N255S possibly damaging Het
Dnah5 A G 15: 28,453,414 (GRCm39) D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 75,874,624 (GRCm39) probably benign Het
Fcnb C T 2: 27,968,330 (GRCm39) S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,217,364 (GRCm39) probably null Het
Lama4 A G 10: 38,954,716 (GRCm39) S1090G probably damaging Het
Malrd1 A G 2: 15,929,931 (GRCm39) D1479G unknown Het
Man2a2 T C 7: 80,010,766 (GRCm39) K742E probably benign Het
Mark3 T C 12: 111,559,117 (GRCm39) I53T probably damaging Het
Mcmdc2 A G 1: 9,986,867 (GRCm39) I219V probably benign Het
Mlycd A T 8: 120,134,332 (GRCm39) E278V probably benign Het
Muc2 G T 7: 141,290,801 (GRCm39) C29F Het
Mup20 T C 4: 61,971,721 (GRCm39) I77V probably benign Het
Myh3 A G 11: 66,982,828 (GRCm39) E849G probably damaging Het
Nedd4 A G 9: 72,593,389 (GRCm39) N154S probably damaging Het
Odad4 G A 11: 100,454,502 (GRCm39) G429E probably benign Het
Or1e1f A T 11: 73,856,240 (GRCm39) I269F probably benign Het
Pcdh7 A T 5: 57,877,678 (GRCm39) N411I probably damaging Het
Plekhm1 A G 11: 103,285,886 (GRCm39) I183T possibly damaging Het
Prkar2a G A 9: 108,569,710 (GRCm39) V19M probably damaging Het
Prss35 T G 9: 86,637,666 (GRCm39) N145K possibly damaging Het
Ranbp2 T A 10: 58,291,747 (GRCm39) D251E possibly damaging Het
Rnf169 C A 7: 99,575,651 (GRCm39) V315F probably damaging Het
Slc32a1 T C 2: 158,455,761 (GRCm39) Y139H probably damaging Het
Slc5a2 T C 7: 127,870,328 (GRCm39) V522A probably benign Het
Slc6a6 A T 6: 91,717,952 (GRCm39) Q297L probably damaging Het
Sos2 A C 12: 69,645,598 (GRCm39) Y914D probably damaging Het
Spata1 G T 3: 146,195,614 (GRCm39) T32N possibly damaging Het
Srcap C T 7: 127,138,369 (GRCm39) R1180C probably damaging Het
St14 A T 9: 31,042,921 (GRCm39) M1K probably null Het
Tcaf1 T C 6: 42,652,236 (GRCm39) T749A probably benign Het
Tcp1 T C 17: 13,141,621 (GRCm39) probably null Het
Tle6 A G 10: 81,426,888 (GRCm39) V576A probably damaging Het
Usp17lc T A 7: 103,067,407 (GRCm39) M234K probably benign Het
Washc4 A G 10: 83,416,163 (GRCm39) I818V possibly damaging Het
Zdhhc18 A G 4: 133,341,165 (GRCm39) L236P probably damaging Het
Zfp266 T C 9: 20,411,610 (GRCm39) D189G probably benign Het
Zfp474 A T 18: 52,772,229 (GRCm39) D294V probably damaging Het
Zfp568 T C 7: 29,722,758 (GRCm39) F568L probably damaging Het
Zfp93 A G 7: 23,975,479 (GRCm39) K488R probably benign Het
Other mutations in Mapk8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Mapk8 APN 14 33,105,857 (GRCm39) missense probably benign 0.01
daughter UTSW 14 33,112,686 (GRCm39) missense probably damaging 1.00
son UTSW 14 33,124,615 (GRCm39) missense probably damaging 1.00
R0255:Mapk8 UTSW 14 33,109,264 (GRCm39) splice site probably benign
R0401:Mapk8 UTSW 14 33,104,165 (GRCm39) missense probably benign 0.37
R0862:Mapk8 UTSW 14 33,114,949 (GRCm39) missense probably damaging 0.98
R0864:Mapk8 UTSW 14 33,114,949 (GRCm39) missense probably damaging 0.98
R1084:Mapk8 UTSW 14 33,110,760 (GRCm39) nonsense probably null
R1637:Mapk8 UTSW 14 33,132,919 (GRCm39) missense probably benign 0.00
R2038:Mapk8 UTSW 14 33,110,893 (GRCm39) nonsense probably null
R3959:Mapk8 UTSW 14 33,104,210 (GRCm39) missense probably null 0.21
R4087:Mapk8 UTSW 14 33,112,205 (GRCm39) missense probably benign 0.00
R4181:Mapk8 UTSW 14 33,104,177 (GRCm39) missense probably damaging 1.00
R4183:Mapk8 UTSW 14 33,104,177 (GRCm39) missense probably damaging 1.00
R4184:Mapk8 UTSW 14 33,104,177 (GRCm39) missense probably damaging 1.00
R5366:Mapk8 UTSW 14 33,112,686 (GRCm39) missense probably damaging 1.00
R6076:Mapk8 UTSW 14 33,112,250 (GRCm39) missense probably damaging 1.00
R6991:Mapk8 UTSW 14 33,132,841 (GRCm39) missense possibly damaging 0.82
R7345:Mapk8 UTSW 14 33,130,068 (GRCm39) missense probably damaging 0.99
R7814:Mapk8 UTSW 14 33,132,834 (GRCm39) nonsense probably null
R8550:Mapk8 UTSW 14 33,124,615 (GRCm39) missense probably damaging 1.00
Z1176:Mapk8 UTSW 14 33,132,843 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGTCACCACATAATAGTTGCTTTG -3'
(R):5'- AGTGCTGGGTTCAATACGATTC -3'

Sequencing Primer
(F):5'- GACCACTGAATTGTTTTTAAAGCAG -3'
(R):5'- GCTGGGTTCAATACGATTCAGCAAC -3'
Posted On 2020-07-13