Incidental Mutation 'R8194:Fam83h'
ID635369
Institutional Source Beutler Lab
Gene Symbol Fam83h
Ensembl Gene ENSMUSG00000046761
Gene Namefamily with sequence similarity 83, member H
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.454) question?
Stock #R8194 (G1)
Quality Score209.458
Status Validated
Chromosome15
Chromosomal Location76001093-76014336 bp(-) (GRCm38)
Type of Mutationsmall deletion (11 aa in frame mutation)
DNA Base Change (assembly) ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT to ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT at 76002775 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060807] [ENSMUST00000089669] [ENSMUST00000170153]
Predicted Effect probably benign
Transcript: ENSMUST00000060807
SMART Domains Protein: ENSMUSP00000059839
Gene: ENSMUSG00000046761

DomainStartEndE-ValueType
Pfam:DUF1669 12 283 3.4e-105 PFAM
low complexity region 304 317 N/A INTRINSIC
low complexity region 562 578 N/A INTRINSIC
low complexity region 629 652 N/A INTRINSIC
low complexity region 671 679 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
internal_repeat_1 836 877 9.35e-9 PROSPERO
internal_repeat_1 877 921 9.35e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000089669
SMART Domains Protein: ENSMUSP00000087098
Gene: ENSMUSG00000063704

DomainStartEndE-ValueType
S_TKc 14 305 7.08e-97 SMART
low complexity region 391 404 N/A INTRINSIC
low complexity region 424 434 N/A INTRINSIC
low complexity region 475 505 N/A INTRINSIC
low complexity region 513 525 N/A INTRINSIC
low complexity region 538 548 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170153
SMART Domains Protein: ENSMUSP00000126453
Gene: ENSMUSG00000046761

DomainStartEndE-ValueType
Pfam:DUF1669 4 284 2.1e-110 PFAM
low complexity region 304 317 N/A INTRINSIC
low complexity region 562 578 N/A INTRINSIC
low complexity region 629 652 N/A INTRINSIC
low complexity region 671 679 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
internal_repeat_1 836 877 9.35e-9 PROSPERO
internal_repeat_1 877 921 9.35e-9 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays an important role in the structural development and calcification of tooth enamel. Defects in this gene are a cause of amelogenesis imperfecta type 3 (AI3). [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230046K03Rik A G 10: 83,580,299 I818V possibly damaging Het
Arid4a T A 12: 71,060,115 Y320* probably null Het
Ash1l T A 3: 89,052,755 C2265S probably damaging Het
Atg4b T A 1: 93,785,972 C55* probably null Het
Cacna1s A T 1: 136,077,692 N405I probably benign Het
Capn11 A T 17: 45,633,399 D526E probably damaging Het
Ccdc188 A G 16: 18,218,380 R71G probably benign Het
Ccser2 G A 14: 36,896,263 R772W probably damaging Het
Cenpf T A 1: 189,682,403 E172D probably benign Het
Cep85 T C 4: 134,134,089 M627V probably null Het
Chd1 G A 17: 17,374,475 probably benign Het
Cnst A G 1: 179,610,194 H441R probably benign Het
Cyp2d11 G T 15: 82,390,437 T313N probably damaging Het
Cyp2g1 A G 7: 26,814,734 N255S possibly damaging Het
Dnah5 A G 15: 28,453,268 D4395G probably damaging Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,327,352 probably null Het
Lama4 A G 10: 39,078,720 S1090G probably damaging Het
Malrd1 A G 2: 15,925,120 D1479G unknown Het
Man2a2 T C 7: 80,361,018 K742E probably benign Het
Mapk8 A T 14: 33,382,284 S392T probably benign Het
Mark3 T C 12: 111,592,683 I53T probably damaging Het
Mcmdc2 A G 1: 9,916,642 I219V probably benign Het
Mlycd A T 8: 119,407,593 E278V probably benign Het
Muc2 G T 7: 141,704,252 C29F Het
Mup20 T C 4: 62,053,484 I77V probably benign Het
Myh3 A G 11: 67,092,002 E849G probably damaging Het
Nedd4 A G 9: 72,686,107 N154S probably damaging Het
Olfr397 A T 11: 73,965,414 I269F probably benign Het
Pcdh7 A T 5: 57,720,336 N411I probably damaging Het
Plekhm1 A G 11: 103,395,060 I183T possibly damaging Het
Prkar2a G A 9: 108,692,511 V19M probably damaging Het
Prss35 T G 9: 86,755,613 N145K possibly damaging Het
Ranbp2 T A 10: 58,455,925 D251E possibly damaging Het
Rnf169 C A 7: 99,926,444 V315F probably damaging Het
Slc32a1 T C 2: 158,613,841 Y139H probably damaging Het
Slc5a2 T C 7: 128,271,156 V522A probably benign Het
Slc6a6 A T 6: 91,740,971 Q297L probably damaging Het
Sos2 A C 12: 69,598,824 Y914D probably damaging Het
Spata1 G T 3: 146,489,859 T32N possibly damaging Het
Srcap C T 7: 127,539,197 R1180C probably damaging Het
St14 A T 9: 31,131,625 M1K probably null Het
Tcaf1 T C 6: 42,675,302 T749A probably benign Het
Tcp1 T C 17: 12,922,734 probably null Het
Tle6 A G 10: 81,591,054 V576A probably damaging Het
Ttc25 G A 11: 100,563,676 G429E probably benign Het
Usp17lc T A 7: 103,418,200 M234K probably benign Het
Zdhhc18 A G 4: 133,613,854 L236P probably damaging Het
Zfp266 T C 9: 20,500,314 D189G probably benign Het
Zfp474 A T 18: 52,639,157 D294V probably damaging Het
Zfp568 T C 7: 30,023,333 F568L probably damaging Het
Zfp93 A G 7: 24,276,054 K488R probably benign Het
Other mutations in Fam83h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Fam83h APN 15 76004036 missense probably damaging 0.98
IGL01463:Fam83h APN 15 76003788 missense possibly damaging 0.57
IGL01789:Fam83h APN 15 76006120 missense probably damaging 1.00
IGL02029:Fam83h APN 15 76006438 missense probably damaging 1.00
IGL02157:Fam83h APN 15 76005055 missense probably damaging 1.00
IGL03225:Fam83h APN 15 76003301 missense probably damaging 1.00
PIT4260001:Fam83h UTSW 15 76001897 missense probably damaging 1.00
R0008:Fam83h UTSW 15 76003962 missense probably damaging 1.00
R0071:Fam83h UTSW 15 76002528 missense probably benign
R0318:Fam83h UTSW 15 76003629 missense probably benign 0.04
R0539:Fam83h UTSW 15 76003227 missense possibly damaging 0.88
R0638:Fam83h UTSW 15 76003927 missense probably benign 0.01
R0790:Fam83h UTSW 15 76003392 missense probably benign 0.43
R0883:Fam83h UTSW 15 76006169 missense probably damaging 1.00
R1970:Fam83h UTSW 15 76006570 unclassified probably benign
R2046:Fam83h UTSW 15 76002938 missense probably benign
R2114:Fam83h UTSW 15 76002297 missense probably damaging 1.00
R2115:Fam83h UTSW 15 76002297 missense probably damaging 1.00
R2117:Fam83h UTSW 15 76004733 nonsense probably null
R3702:Fam83h UTSW 15 76002650 missense probably benign
R3842:Fam83h UTSW 15 76002650 missense probably benign
R4729:Fam83h UTSW 15 76002336 missense probably benign
R4791:Fam83h UTSW 15 76002368 missense probably damaging 1.00
R5024:Fam83h UTSW 15 76005142 missense probably damaging 1.00
R5471:Fam83h UTSW 15 76002903 missense probably benign 0.00
R6013:Fam83h UTSW 15 76004000 missense probably damaging 0.99
R6488:Fam83h UTSW 15 76002053 missense possibly damaging 0.67
R6558:Fam83h UTSW 15 76004453 missense probably damaging 1.00
R6618:Fam83h UTSW 15 76003511 missense probably damaging 1.00
R7030:Fam83h UTSW 15 76004739 missense probably benign 0.08
R7148:Fam83h UTSW 15 76005167 missense probably damaging 0.98
R7191:Fam83h UTSW 15 76003037 missense probably damaging 1.00
R7438:Fam83h UTSW 15 76004426 missense possibly damaging 0.93
R7705:Fam83h UTSW 15 76003850 missense probably damaging 0.99
R8218:Fam83h UTSW 15 76003037 missense probably damaging 1.00
R8282:Fam83h UTSW 15 76002775 small deletion probably benign
R8293:Fam83h UTSW 15 76002775 small deletion probably benign
X0010:Fam83h UTSW 15 76004939 critical splice donor site probably null
X0061:Fam83h UTSW 15 76003503 missense probably damaging 1.00
Z1177:Fam83h UTSW 15 76002962 missense probably benign 0.00
Z1177:Fam83h UTSW 15 76006541 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAAAGTGAGACTGCCTCTG -3'
(R):5'- TCTCCACAAGGTCGAGATAGC -3'

Sequencing Primer
(F):5'- GCACAGGGGGTACTGGACTAC -3'
(R):5'- AAGGTCGAGATAGCCCTCC -3'
Posted On2020-07-13