Incidental Mutation 'R8194:Ccdc188'
ID635371
Institutional Source Beutler Lab
Gene Symbol Ccdc188
Ensembl Gene ENSMUSG00000090777
Gene Namecoiled-coil domain containing 188
SynonymsGm7873
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R8194 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location18217879-18220348 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18218380 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 71 (R71G)
Ref Sequence ENSEMBL: ENSMUSP00000132278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076957] [ENSMUST00000167061]
Predicted Effect probably benign
Transcript: ENSMUST00000076957
SMART Domains Protein: ENSMUSP00000076224
Gene: ENSMUSG00000060166

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
Pfam:zf-DHHC 99 224 4.8e-36 PFAM
low complexity region 304 318 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
low complexity region 551 563 N/A INTRINSIC
low complexity region 619 644 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167061
AA Change: R71G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132278
Gene: ENSMUSG00000090777
AA Change: R71G

DomainStartEndE-ValueType
low complexity region 13 36 N/A INTRINSIC
low complexity region 60 71 N/A INTRINSIC
coiled coil region 88 123 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230046K03Rik A G 10: 83,580,299 I818V possibly damaging Het
Arid4a T A 12: 71,060,115 Y320* probably null Het
Ash1l T A 3: 89,052,755 C2265S probably damaging Het
Atg4b T A 1: 93,785,972 C55* probably null Het
Cacna1s A T 1: 136,077,692 N405I probably benign Het
Capn11 A T 17: 45,633,399 D526E probably damaging Het
Ccser2 G A 14: 36,896,263 R772W probably damaging Het
Cenpf T A 1: 189,682,403 E172D probably benign Het
Cep85 T C 4: 134,134,089 M627V probably null Het
Chd1 G A 17: 17,374,475 probably benign Het
Cnst A G 1: 179,610,194 H441R probably benign Het
Cyp2d11 G T 15: 82,390,437 T313N probably damaging Het
Cyp2g1 A G 7: 26,814,734 N255S possibly damaging Het
Dnah5 A G 15: 28,453,268 D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,327,352 probably null Het
Lama4 A G 10: 39,078,720 S1090G probably damaging Het
Malrd1 A G 2: 15,925,120 D1479G unknown Het
Man2a2 T C 7: 80,361,018 K742E probably benign Het
Mapk8 A T 14: 33,382,284 S392T probably benign Het
Mark3 T C 12: 111,592,683 I53T probably damaging Het
Mcmdc2 A G 1: 9,916,642 I219V probably benign Het
Mlycd A T 8: 119,407,593 E278V probably benign Het
Muc2 G T 7: 141,704,252 C29F Het
Mup20 T C 4: 62,053,484 I77V probably benign Het
Myh3 A G 11: 67,092,002 E849G probably damaging Het
Nedd4 A G 9: 72,686,107 N154S probably damaging Het
Olfr397 A T 11: 73,965,414 I269F probably benign Het
Pcdh7 A T 5: 57,720,336 N411I probably damaging Het
Plekhm1 A G 11: 103,395,060 I183T possibly damaging Het
Prkar2a G A 9: 108,692,511 V19M probably damaging Het
Prss35 T G 9: 86,755,613 N145K possibly damaging Het
Ranbp2 T A 10: 58,455,925 D251E possibly damaging Het
Rnf169 C A 7: 99,926,444 V315F probably damaging Het
Slc32a1 T C 2: 158,613,841 Y139H probably damaging Het
Slc5a2 T C 7: 128,271,156 V522A probably benign Het
Slc6a6 A T 6: 91,740,971 Q297L probably damaging Het
Sos2 A C 12: 69,598,824 Y914D probably damaging Het
Spata1 G T 3: 146,489,859 T32N possibly damaging Het
Srcap C T 7: 127,539,197 R1180C probably damaging Het
St14 A T 9: 31,131,625 M1K probably null Het
Tcaf1 T C 6: 42,675,302 T749A probably benign Het
Tcp1 T C 17: 12,922,734 probably null Het
Tle6 A G 10: 81,591,054 V576A probably damaging Het
Ttc25 G A 11: 100,563,676 G429E probably benign Het
Usp17lc T A 7: 103,418,200 M234K probably benign Het
Zdhhc18 A G 4: 133,613,854 L236P probably damaging Het
Zfp266 T C 9: 20,500,314 D189G probably benign Het
Zfp474 A T 18: 52,639,157 D294V probably damaging Het
Zfp568 T C 7: 30,023,333 F568L probably damaging Het
Zfp93 A G 7: 24,276,054 K488R probably benign Het
Other mutations in Ccdc188
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0309:Ccdc188 UTSW 16 18219305 missense possibly damaging 0.83
R0594:Ccdc188 UTSW 16 18218920 missense probably benign 0.10
R1479:Ccdc188 UTSW 16 18219290 missense possibly damaging 0.92
R1757:Ccdc188 UTSW 16 18218688 missense probably damaging 1.00
R1986:Ccdc188 UTSW 16 18218843 missense probably damaging 0.96
R2327:Ccdc188 UTSW 16 18219206 missense probably damaging 1.00
R4404:Ccdc188 UTSW 16 18218420 missense probably damaging 0.98
R4690:Ccdc188 UTSW 16 18218295 missense probably damaging 1.00
R4914:Ccdc188 UTSW 16 18218219 missense probably benign 0.03
R5238:Ccdc188 UTSW 16 18219174 missense probably damaging 1.00
R6844:Ccdc188 UTSW 16 18218210 missense probably damaging 1.00
R7811:Ccdc188 UTSW 16 18218450 missense probably benign 0.30
R7832:Ccdc188 UTSW 16 18218675 missense probably damaging 1.00
R8066:Ccdc188 UTSW 16 18219194 missense probably damaging 1.00
R8101:Ccdc188 UTSW 16 18218012 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCCCCTGGGATGTTTCTG -3'
(R):5'- TTGCTTCTCAGGCAGGAAGC -3'

Sequencing Primer
(F):5'- TTTCTGTCAAGCGAAGGAGAGATCC -3'
(R):5'- CTTCTCAGGCAGGAAGCTGAAG -3'
Posted On2020-07-13