Incidental Mutation 'R8194:Tcp1'
ID635372
Institutional Source Beutler Lab
Gene Symbol Tcp1
Ensembl Gene ENSMUSG00000068039
Gene Namet-complex protein 1
Synonymsp63, CCT, Ccta, Cct1, c-cpn, Tp63, Tcp-1, TRic
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R8194 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location12915701-12925067 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 12922734 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043923] [ENSMUST00000089024] [ENSMUST00000143961] [ENSMUST00000151287] [ENSMUST00000160378]
Predicted Effect probably benign
Transcript: ENSMUST00000043923
SMART Domains Protein: ENSMUSP00000045912
Gene: ENSMUSG00000062480

DomainStartEndE-ValueType
Pfam:Thiolase_N 8 267 2.9e-97 PFAM
Pfam:Thiolase_C 274 396 1.3e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000089024
SMART Domains Protein: ENSMUSP00000086418
Gene: ENSMUSG00000068039

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 1 486 1.9e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143961
SMART Domains Protein: ENSMUSP00000116511
Gene: ENSMUSG00000068039

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 28 103 1.2e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000151287
SMART Domains Protein: ENSMUSP00000116108
Gene: ENSMUSG00000068039

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 28 535 6.3e-156 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160378
SMART Domains Protein: ENSMUSP00000125454
Gene: ENSMUSG00000062480

DomainStartEndE-ValueType
Pfam:Thiolase_N 5 248 5.6e-91 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternate transcriptional splice variants of this gene, encoding different isoforms, have been characterized. In addition, three pseudogenes that appear to be derived from this gene have been found. [provided by RefSeq, Jun 2010]
PHENOTYPE: There are two electrophoretic alleles known; allele a occurs in all complete t haplotype chromosomes and allele b in wild-type strains. There are multiple changes between the amino acid sequences of the TCP1A and TCP1B proteins encoded by the two alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230046K03Rik A G 10: 83,580,299 I818V possibly damaging Het
Arid4a T A 12: 71,060,115 Y320* probably null Het
Ash1l T A 3: 89,052,755 C2265S probably damaging Het
Atg4b T A 1: 93,785,972 C55* probably null Het
Cacna1s A T 1: 136,077,692 N405I probably benign Het
Capn11 A T 17: 45,633,399 D526E probably damaging Het
Ccdc188 A G 16: 18,218,380 R71G probably benign Het
Ccser2 G A 14: 36,896,263 R772W probably damaging Het
Cenpf T A 1: 189,682,403 E172D probably benign Het
Cep85 T C 4: 134,134,089 M627V probably null Het
Chd1 G A 17: 17,374,475 probably benign Het
Cnst A G 1: 179,610,194 H441R probably benign Het
Cyp2d11 G T 15: 82,390,437 T313N probably damaging Het
Cyp2g1 A G 7: 26,814,734 N255S possibly damaging Het
Dnah5 A G 15: 28,453,268 D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,327,352 probably null Het
Lama4 A G 10: 39,078,720 S1090G probably damaging Het
Malrd1 A G 2: 15,925,120 D1479G unknown Het
Man2a2 T C 7: 80,361,018 K742E probably benign Het
Mapk8 A T 14: 33,382,284 S392T probably benign Het
Mark3 T C 12: 111,592,683 I53T probably damaging Het
Mcmdc2 A G 1: 9,916,642 I219V probably benign Het
Mlycd A T 8: 119,407,593 E278V probably benign Het
Muc2 G T 7: 141,704,252 C29F Het
Mup20 T C 4: 62,053,484 I77V probably benign Het
Myh3 A G 11: 67,092,002 E849G probably damaging Het
Nedd4 A G 9: 72,686,107 N154S probably damaging Het
Olfr397 A T 11: 73,965,414 I269F probably benign Het
Pcdh7 A T 5: 57,720,336 N411I probably damaging Het
Plekhm1 A G 11: 103,395,060 I183T possibly damaging Het
Prkar2a G A 9: 108,692,511 V19M probably damaging Het
Prss35 T G 9: 86,755,613 N145K possibly damaging Het
Ranbp2 T A 10: 58,455,925 D251E possibly damaging Het
Rnf169 C A 7: 99,926,444 V315F probably damaging Het
Slc32a1 T C 2: 158,613,841 Y139H probably damaging Het
Slc5a2 T C 7: 128,271,156 V522A probably benign Het
Slc6a6 A T 6: 91,740,971 Q297L probably damaging Het
Sos2 A C 12: 69,598,824 Y914D probably damaging Het
Spata1 G T 3: 146,489,859 T32N possibly damaging Het
Srcap C T 7: 127,539,197 R1180C probably damaging Het
St14 A T 9: 31,131,625 M1K probably null Het
Tcaf1 T C 6: 42,675,302 T749A probably benign Het
Tle6 A G 10: 81,591,054 V576A probably damaging Het
Ttc25 G A 11: 100,563,676 G429E probably benign Het
Usp17lc T A 7: 103,418,200 M234K probably benign Het
Zdhhc18 A G 4: 133,613,854 L236P probably damaging Het
Zfp266 T C 9: 20,500,314 D189G probably benign Het
Zfp474 A T 18: 52,639,157 D294V probably damaging Het
Zfp568 T C 7: 30,023,333 F568L probably damaging Het
Zfp93 A G 7: 24,276,054 K488R probably benign Het
Other mutations in Tcp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01624:Tcp1 APN 17 12919925 missense probably benign 0.00
IGL01859:Tcp1 APN 17 12922684 missense possibly damaging 0.95
IGL02635:Tcp1 APN 17 12923409 missense probably benign 0.35
R0164:Tcp1 UTSW 17 12922747 unclassified probably benign
R0308:Tcp1 UTSW 17 12920419 missense probably benign 0.14
R0452:Tcp1 UTSW 17 12924352 missense probably benign 0.14
R0661:Tcp1 UTSW 17 12923313 missense probably benign 0.02
R0674:Tcp1 UTSW 17 12923244 missense probably damaging 1.00
R1078:Tcp1 UTSW 17 12923204 unclassified probably benign
R1434:Tcp1 UTSW 17 12922606 splice site probably null
R1678:Tcp1 UTSW 17 12920423 missense probably benign
R1801:Tcp1 UTSW 17 12922202 nonsense probably null
R2063:Tcp1 UTSW 17 12920812 missense probably damaging 0.99
R4061:Tcp1 UTSW 17 12920863 missense probably benign
R4078:Tcp1 UTSW 17 12918083 missense probably benign 0.05
R5516:Tcp1 UTSW 17 12924334 missense probably damaging 0.98
R5620:Tcp1 UTSW 17 12919337 splice site probably null
R5764:Tcp1 UTSW 17 12916602 missense probably benign 0.10
R6729:Tcp1 UTSW 17 12923253 missense probably damaging 1.00
R7112:Tcp1 UTSW 17 12917873 missense probably damaging 0.99
R7614:Tcp1 UTSW 17 12922653 missense possibly damaging 0.83
R7718:Tcp1 UTSW 17 12922162 missense probably damaging 1.00
R8239:Tcp1 UTSW 17 12920851 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGGAACCTTGAGATAATGCACTG -3'
(R):5'- AAGGCACCAGGAACAATGTC -3'

Sequencing Primer
(F):5'- TGAGATAATGCACTGCTTTTCC -3'
(R):5'- ACAATGTCTAGACCATGTACGAG -3'
Posted On2020-07-13