Incidental Mutation 'R8195:Arfgef1'
ID635376
Institutional Source Beutler Lab
Gene Symbol Arfgef1
Ensembl Gene ENSMUSG00000067851
Gene NameADP-ribosylation factor guanine nucleotide-exchange factor 1(brefeldin A-inhibited)
SynonymsP200, ARFGEP1, BIG1, D130059B05Rik, D730028O18Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001102430.1

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8195 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location10137571-10232670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10173253 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1024 (K1024E)
Ref Sequence ENSEMBL: ENSMUSP00000085986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088615] [ENSMUST00000131556]
Predicted Effect probably damaging
Transcript: ENSMUST00000088615
AA Change: K1024E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085986
Gene: ENSMUSG00000067851
AA Change: K1024E

DomainStartEndE-ValueType
Pfam:DCB 28 213 5.2e-45 PFAM
low complexity region 221 233 N/A INTRINSIC
low complexity region 291 306 N/A INTRINSIC
Pfam:Sec7_N 416 575 1.3e-52 PFAM
Blast:Sec7 588 637 6e-24 BLAST
low complexity region 661 681 N/A INTRINSIC
Sec7 692 879 1.15e-105 SMART
Blast:Sec7 897 933 6e-13 BLAST
Blast:Sec7 947 986 8e-18 BLAST
Pfam:DUF1981 1217 1300 3.6e-39 PFAM
low complexity region 1587 1602 N/A INTRINSIC
low complexity region 1777 1782 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131556
AA Change: K1024E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118805
Gene: ENSMUSG00000067851
AA Change: K1024E

DomainStartEndE-ValueType
coiled coil region 207 234 N/A INTRINSIC
low complexity region 291 306 N/A INTRINSIC
Pfam:Sec7_N 413 576 3.1e-59 PFAM
Blast:Sec7 588 637 2e-24 BLAST
low complexity region 661 681 N/A INTRINSIC
Sec7 692 879 1.15e-105 SMART
Blast:Sec7 897 933 3e-13 BLAST
Blast:Sec7 947 986 2e-18 BLAST
Meta Mutation Damage Score 0.4052 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation factors (ARFs) play an important role in intracellular vesicular trafficking. The protein encoded by this gene is involved in the activation of ARFs by accelerating replacement of bound GDP with GTP. It contains a Sec7 domain, which may be responsible for guanine-nucleotide exchange activity and also brefeldin A inhibition. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, absent gastric milk and decreased brain size with increased neuron apoptosis, abnormal axon guidance and hypersensitivity to glutamate. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,274,735 G483R probably benign Het
Abca9 T C 11: 110,138,329 D801G probably benign Het
Aldob T C 4: 49,538,822 N232S probably damaging Het
Ankhd1 T C 18: 36,654,177 V322A Het
Arhgef40 T A 14: 51,988,769 V90E probably damaging Het
Cblc A T 7: 19,785,337 S399R possibly damaging Het
Ccdc17 T A 4: 116,599,014 I368K possibly damaging Het
Ccdc17 T A 4: 116,599,016 W369R probably damaging Het
Cd276 G A 9: 58,537,472 T72I probably damaging Het
Cdk14 C T 5: 5,227,159 probably null Het
Cfap61 C T 2: 145,947,175 S33L probably benign Het
Cmtm2a A G 8: 104,293,038 F7L probably benign Het
Eif2ak4 T C 2: 118,450,338 I1062T possibly damaging Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Fxr1 A T 3: 34,047,729 E204V probably damaging Het
Fzd6 T A 15: 39,031,564 L375Q probably damaging Het
Ggta1 T A 2: 35,422,267 E33V probably damaging Het
Gnb1l T A 16: 18,544,215 I119N probably benign Het
Gpsm1 A G 2: 26,324,917 probably null Het
Hecw1 A G 13: 14,306,107 I885T probably damaging Het
Itgb8 T C 12: 119,168,170 D580G probably damaging Het
Kbtbd12 T A 6: 88,617,931 T306S possibly damaging Het
Kctd1 C T 18: 15,063,243 E108K unknown Het
Lrrc36 A G 8: 105,452,085 D304G possibly damaging Het
Lrrn2 A G 1: 132,937,344 E49G probably damaging Het
Lysmd2 C A 9: 75,626,028 Y88* probably null Het
Lzts3 A G 2: 130,635,185 S448P probably benign Het
Meioc T A 11: 102,675,067 L447* probably null Het
Mybpc1 A G 10: 88,558,691 I244T possibly damaging Het
Necab3 G A 2: 154,547,443 A160V probably benign Het
Nek8 G T 11: 78,170,761 P314Q possibly damaging Het
Nlrp5 A G 7: 23,413,337 T140A probably benign Het
Olfr655 A T 7: 104,596,926 F85Y probably damaging Het
Olfr763 T C 10: 129,011,575 C97R probably damaging Het
Olfr860 A T 9: 19,846,484 I45N probably damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pgm3 G A 9: 86,570,321 R29W probably damaging Het
Ppp2r3a A G 9: 101,213,032 C31R probably damaging Het
Prom1 C T 5: 44,037,428 S334N possibly damaging Het
Rai14 C T 15: 10,575,216 S581N probably benign Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rgs16 T C 1: 153,740,943 F42S probably benign Het
Slc2a6 T G 2: 27,027,826 E27A probably benign Het
Slc38a1 G A 15: 96,592,566 S110L probably benign Het
Sox30 C T 11: 45,991,765 R541C probably benign Het
Sptbn4 C A 7: 27,408,889 E703* probably null Het
Tjp1 A T 7: 65,343,722 F34L probably damaging Het
Trim65 T C 11: 116,126,211 Q475R probably benign Het
Ttc38 A T 15: 85,844,515 R223* probably null Het
Tulp1 T C 17: 28,364,326 Q80R probably benign Het
Utp23 T C 15: 51,882,202 F139L possibly damaging Het
Vmn1r121 A T 7: 21,098,303 F71I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zdbf2 T C 1: 63,304,066 S535P possibly damaging Het
Zfp788 T G 7: 41,649,377 M479R probably benign Het
Other mutations in Arfgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Arfgef1 APN 1 10199787 missense probably benign
IGL00919:Arfgef1 APN 1 10173237 missense probably damaging 1.00
IGL01022:Arfgef1 APN 1 10174076 missense probably damaging 1.00
IGL01155:Arfgef1 APN 1 10198982 splice site probably benign
IGL01288:Arfgef1 APN 1 10213211 missense possibly damaging 0.67
IGL01397:Arfgef1 APN 1 10159571 missense probably benign 0.40
IGL01433:Arfgef1 APN 1 10153432 missense probably damaging 1.00
IGL01653:Arfgef1 APN 1 10159908 nonsense probably null
IGL01669:Arfgef1 APN 1 10159615 missense probably damaging 1.00
IGL01795:Arfgef1 APN 1 10147528 missense probably benign 0.01
IGL01860:Arfgef1 APN 1 10154396 missense probably damaging 1.00
IGL02137:Arfgef1 APN 1 10213113 missense probably damaging 1.00
IGL02365:Arfgef1 APN 1 10199883 missense probably benign 0.00
IGL02519:Arfgef1 APN 1 10209668 missense probably benign 0.13
IGL02542:Arfgef1 APN 1 10172842 missense probably benign 0.24
IGL02604:Arfgef1 APN 1 10181050 splice site probably benign
IGL02743:Arfgef1 APN 1 10199829 missense probably benign 0.00
IGL03225:Arfgef1 APN 1 10154318 missense probably damaging 1.00
Collected UTSW 1 10180938 missense probably damaging 1.00
uncle_joe UTSW 1 10160835 missense probably damaging 1.00
I2288:Arfgef1 UTSW 1 10173253 missense probably damaging 1.00
I2289:Arfgef1 UTSW 1 10173253 missense probably damaging 1.00
R0383:Arfgef1 UTSW 1 10198842 critical splice donor site probably null
R0491:Arfgef1 UTSW 1 10179987 splice site probably benign
R0636:Arfgef1 UTSW 1 10199851 missense probably benign
R1006:Arfgef1 UTSW 1 10140481 missense probably benign 0.00
R1212:Arfgef1 UTSW 1 10216559 missense probably benign 0.05
R1233:Arfgef1 UTSW 1 10184090 missense probably damaging 1.00
R1346:Arfgef1 UTSW 1 10159733 missense probably benign 0.41
R1416:Arfgef1 UTSW 1 10172939 missense probably damaging 1.00
R1477:Arfgef1 UTSW 1 10189284 missense probably damaging 1.00
R1581:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R1587:Arfgef1 UTSW 1 10159959 missense probably damaging 0.99
R1602:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1745:Arfgef1 UTSW 1 10173255 missense probably damaging 1.00
R1831:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1832:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1833:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1918:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R1919:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2059:Arfgef1 UTSW 1 10188752 splice site probably null
R2146:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2148:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2149:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2150:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2373:Arfgef1 UTSW 1 10174142 missense probably damaging 1.00
R2516:Arfgef1 UTSW 1 10153654 missense possibly damaging 0.89
R3863:Arfgef1 UTSW 1 10142586 frame shift probably null
R3916:Arfgef1 UTSW 1 10189443 missense probably benign 0.01
R3948:Arfgef1 UTSW 1 10142586 frame shift probably null
R3949:Arfgef1 UTSW 1 10142586 frame shift probably null
R3977:Arfgef1 UTSW 1 10209634 missense probably benign 0.01
R3978:Arfgef1 UTSW 1 10209634 missense probably benign 0.01
R3979:Arfgef1 UTSW 1 10209634 missense probably benign 0.01
R4086:Arfgef1 UTSW 1 10163759 missense probably benign 0.06
R4175:Arfgef1 UTSW 1 10159636 missense probably damaging 1.00
R4257:Arfgef1 UTSW 1 10159546 intron probably benign
R4572:Arfgef1 UTSW 1 10213141 missense probably damaging 1.00
R4652:Arfgef1 UTSW 1 10173262 missense probably damaging 0.98
R4678:Arfgef1 UTSW 1 10142666 missense probably benign 0.03
R4737:Arfgef1 UTSW 1 10189611 missense possibly damaging 0.85
R4779:Arfgef1 UTSW 1 10153733 missense probably damaging 1.00
R4818:Arfgef1 UTSW 1 10216547 missense probably benign
R4898:Arfgef1 UTSW 1 10159573 missense possibly damaging 0.75
R4979:Arfgef1 UTSW 1 10213109 missense probably damaging 1.00
R5039:Arfgef1 UTSW 1 10199736 missense probably benign 0.37
R5194:Arfgef1 UTSW 1 10204907 missense probably benign 0.09
R5428:Arfgef1 UTSW 1 10160835 missense probably damaging 1.00
R5533:Arfgef1 UTSW 1 10199727 critical splice donor site probably null
R5547:Arfgef1 UTSW 1 10160976 missense probably damaging 1.00
R5562:Arfgef1 UTSW 1 10144746 missense probably damaging 1.00
R5635:Arfgef1 UTSW 1 10188860 missense possibly damaging 0.81
R5697:Arfgef1 UTSW 1 10160838 missense probably benign 0.03
R5704:Arfgef1 UTSW 1 10159583 missense probably damaging 0.98
R5722:Arfgef1 UTSW 1 10138884 missense probably benign 0.04
R5793:Arfgef1 UTSW 1 10209528 missense probably benign 0.01
R5835:Arfgef1 UTSW 1 10160739 missense probably damaging 1.00
R5870:Arfgef1 UTSW 1 10180938 missense probably damaging 1.00
R5990:Arfgef1 UTSW 1 10172921 missense probably damaging 0.99
R6290:Arfgef1 UTSW 1 10188811 missense possibly damaging 0.91
R6460:Arfgef1 UTSW 1 10213060 missense probably damaging 1.00
R6613:Arfgef1 UTSW 1 10194396 missense possibly damaging 0.95
R6802:Arfgef1 UTSW 1 10189452 missense probably benign 0.35
R6967:Arfgef1 UTSW 1 10153678 missense probably damaging 1.00
R6967:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R6968:Arfgef1 UTSW 1 10153678 missense probably damaging 1.00
R6968:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R6969:Arfgef1 UTSW 1 10153678 missense probably damaging 1.00
R6969:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R6970:Arfgef1 UTSW 1 10153678 missense probably damaging 1.00
R6970:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R7092:Arfgef1 UTSW 1 10153676 missense probably damaging 1.00
R7251:Arfgef1 UTSW 1 10198975 missense possibly damaging 0.81
R7334:Arfgef1 UTSW 1 10184460 missense probably damaging 1.00
R7399:Arfgef1 UTSW 1 10180897 missense probably benign 0.00
R7631:Arfgef1 UTSW 1 10232469 missense probably benign 0.00
R7699:Arfgef1 UTSW 1 10194411 missense possibly damaging 0.78
R7700:Arfgef1 UTSW 1 10194411 missense possibly damaging 0.78
R7772:Arfgef1 UTSW 1 10157010 missense possibly damaging 0.96
R7968:Arfgef1 UTSW 1 10172920 missense probably damaging 1.00
R8292:Arfgef1 UTSW 1 10156969 missense probably benign 0.06
R8301:Arfgef1 UTSW 1 10179833 missense probably damaging 1.00
R8341:Arfgef1 UTSW 1 10154328 missense probably benign 0.37
R8410:Arfgef1 UTSW 1 10159642 missense possibly damaging 0.94
R8411:Arfgef1 UTSW 1 10216534 missense probably benign 0.01
V1662:Arfgef1 UTSW 1 10173253 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTTCAGGATCTACAGCAC -3'
(R):5'- AATTAGAGGCCAGTGTGCTG -3'

Sequencing Primer
(F):5'- TTCAGGATCTACAGCACAGAAAG -3'
(R):5'- CCAGTGTGCTGTGTTTTCAAC -3'
Posted On2020-07-13