Mutagenetix > Incidental Mutation

Incidental Mutation 'R8195:Zdbf2'

635377

Institutional Source

Beutler Lab

Gene Symbol

Zdbf2

Ensembl Gene

ENSMUSG00000027520

Gene Name

zinc finger, DBF-type containing 2

Synonyms

4930431J08Rik, 9330107J05Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R8195 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63273265-63314576 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 63304066 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 535 (S535P)

Ref Sequence

ENSEMBL: ENSMUSP00000029025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]

AlphaFold

Q5SS00

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029025
AA Change: S535P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: S535P

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114132
AA Change: S535P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: S535P

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	G	A	11: 9,274,735	G483R	probably benign	Het
Abca9	T	C	11: 110,138,329	D801G	probably benign	Het
Aldob	T	C	4: 49,538,822	N232S	probably damaging	Het
Ankhd1	T	C	18: 36,654,177	V322A		Het
Arfgef1	T	C	1: 10,173,253	K1024E	probably damaging	Het
Arhgef40	T	A	14: 51,988,769	V90E	probably damaging	Het
Cblc	A	T	7: 19,785,337	S399R	possibly damaging	Het
Ccdc17	T	A	4: 116,599,014	I368K	possibly damaging	Het
Ccdc17	T	A	4: 116,599,016	W369R	probably damaging	Het
Cd276	G	A	9: 58,537,472	T72I	probably damaging	Het
Cdk14	C	T	5: 5,227,159		probably null	Het
Cfap61	C	T	2: 145,947,175	S33L	probably benign	Het
Cmtm2a	A	G	8: 104,293,038	F7L	probably benign	Het
Eif2ak4	T	C	2: 118,450,338	I1062T	possibly damaging	Het
Fcnb	C	T	2: 28,078,318	S209N	possibly damaging	Het
Fxr1	A	T	3: 34,047,729	E204V	probably damaging	Het
Fzd6	T	A	15: 39,031,564	L375Q	probably damaging	Het
Ggta1	T	A	2: 35,422,267	E33V	probably damaging	Het
Gnb1l	T	A	16: 18,544,215	I119N	probably benign	Het
Gpsm1	A	G	2: 26,324,917		probably null	Het
Hecw1	A	G	13: 14,306,107	I885T	probably damaging	Het
Itgb8	T	C	12: 119,168,170	D580G	probably damaging	Het
Kbtbd12	T	A	6: 88,617,931	T306S	possibly damaging	Het
Kctd1	C	T	18: 15,063,243	E108K	unknown	Het
Lrrc36	A	G	8: 105,452,085	D304G	possibly damaging	Het
Lrrn2	A	G	1: 132,937,344	E49G	probably damaging	Het
Lysmd2	C	A	9: 75,626,028	Y88*	probably null	Het
Lzts3	A	G	2: 130,635,185	S448P	probably benign	Het
Meioc	T	A	11: 102,675,067	L447*	probably null	Het
Mybpc1	A	G	10: 88,558,691	I244T	possibly damaging	Het
Necab3	G	A	2: 154,547,443	A160V	probably benign	Het
Nek8	G	T	11: 78,170,761	P314Q	possibly damaging	Het
Nlrp5	A	G	7: 23,413,337	T140A	probably benign	Het
Olfr655	A	T	7: 104,596,926	F85Y	probably damaging	Het
Olfr763	T	C	10: 129,011,575	C97R	probably damaging	Het
Olfr860	A	T	9: 19,846,484	I45N	probably damaging	Het
Olfr921	G	A	9: 38,775,281	V9M	noncoding transcript	Het
Pgm3	G	A	9: 86,570,321	R29W	probably damaging	Het
Ppp2r3a	A	G	9: 101,213,032	C31R	probably damaging	Het
Prom1	C	T	5: 44,037,428	S334N	possibly damaging	Het
Rai14	C	T	15: 10,575,216	S581N	probably benign	Het
Rbm46	C	T	3: 82,865,468	R119Q	probably benign	Het
Rgs16	T	C	1: 153,740,943	F42S	probably benign	Het
Slc2a6	T	G	2: 27,027,826	E27A	probably benign	Het
Slc38a1	G	A	15: 96,592,566	S110L	probably benign	Het
Sox30	C	T	11: 45,991,765	R541C	probably benign	Het
Sptbn4	C	A	7: 27,408,889	E703*	probably null	Het
Tjp1	A	T	7: 65,343,722	F34L	probably damaging	Het
Trim65	T	C	11: 116,126,211	Q475R	probably benign	Het
Ttc38	A	T	15: 85,844,515	R223*	probably null	Het
Tulp1	T	C	17: 28,364,326	Q80R	probably benign	Het
Utp23	T	C	15: 51,882,202	F139L	possibly damaging	Het
Vmn1r121	A	T	7: 21,098,303	F71I	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Zfp788	T	G	7: 41,649,377	M479R	probably benign	Het

Other mutations in Zdbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Zdbf2	APN	1	63306514	missense	possibly damaging	0.92
IGL00796:Zdbf2	APN	1	63307205	missense	probably benign	0.04
IGL00801:Zdbf2	APN	1	63303038	missense	possibly damaging	0.66
IGL02803:Zdbf2	APN	1	63303077	missense	possibly damaging	0.46
R0143:Zdbf2	UTSW	1	63308074	missense	probably benign	0.01
R0147:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0148:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0433:Zdbf2	UTSW	1	63306143	missense	possibly damaging	0.46
R0502:Zdbf2	UTSW	1	63305290	missense	possibly damaging	0.66
R0645:Zdbf2	UTSW	1	63304950	missense	possibly damaging	0.81
R0765:Zdbf2	UTSW	1	63305723	missense	possibly damaging	0.46
R1068:Zdbf2	UTSW	1	63303430	missense	possibly damaging	0.94
R1216:Zdbf2	UTSW	1	63303002	missense	possibly damaging	0.83
R1235:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R1352:Zdbf2	UTSW	1	63303053	missense	probably damaging	0.96
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1435:Zdbf2	UTSW	1	63303040	missense	possibly damaging	0.66
R1562:Zdbf2	UTSW	1	63303588	missense	possibly damaging	0.83
R1624:Zdbf2	UTSW	1	63303859	missense	possibly damaging	0.66
R1635:Zdbf2	UTSW	1	63304334	missense	possibly damaging	0.92
R1644:Zdbf2	UTSW	1	63308972	missense	possibly damaging	0.66
R1662:Zdbf2	UTSW	1	63304249	nonsense	probably null
R1700:Zdbf2	UTSW	1	63302741	missense	unknown
R1720:Zdbf2	UTSW	1	63303277	missense	possibly damaging	0.46
R1853:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1854:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1973:Zdbf2	UTSW	1	63309701	missense	unknown
R2336:Zdbf2	UTSW	1	63303464	missense	probably benign	0.00
R2428:Zdbf2	UTSW	1	63305615	missense	probably benign	0.04
R3010:Zdbf2	UTSW	1	63303065	missense	possibly damaging	0.92
R3034:Zdbf2	UTSW	1	63304205	missense	probably damaging	0.96
R3079:Zdbf2	UTSW	1	63307477	missense	probably benign	0.05
R3196:Zdbf2	UTSW	1	63308420	missense	possibly damaging	0.46
R3711:Zdbf2	UTSW	1	63308671	missense	possibly damaging	0.83
R3845:Zdbf2	UTSW	1	63308324	missense	possibly damaging	0.66
R4093:Zdbf2	UTSW	1	63309781	missense	possibly damaging	0.83
R4250:Zdbf2	UTSW	1	63302861	missense	possibly damaging	0.46
R4592:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R4721:Zdbf2	UTSW	1	63308792	missense	possibly damaging	0.46
R4779:Zdbf2	UTSW	1	63303238	missense	possibly damaging	0.66
R4928:Zdbf2	UTSW	1	63308814	missense	possibly damaging	0.81
R4943:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.92
R5025:Zdbf2	UTSW	1	63303650	missense	possibly damaging	0.82
R5095:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R5149:Zdbf2	UTSW	1	63304903	missense	possibly damaging	0.83
R5326:Zdbf2	UTSW	1	63304411	missense	possibly damaging	0.66
R5341:Zdbf2	UTSW	1	63307933	missense	probably benign	0.27
R5511:Zdbf2	UTSW	1	63305677	missense	probably benign	0.03
R5809:Zdbf2	UTSW	1	63305876	missense	possibly damaging	0.90
R5902:Zdbf2	UTSW	1	63306526	missense	possibly damaging	0.83
R6162:Zdbf2	UTSW	1	63280818	start gained	probably benign
R6245:Zdbf2	UTSW	1	63304433	missense	possibly damaging	0.46
R6332:Zdbf2	UTSW	1	63307822	missense	possibly damaging	0.66
R6361:Zdbf2	UTSW	1	63303321	missense	possibly damaging	0.66
R6489:Zdbf2	UTSW	1	63307478	missense	possibly damaging	0.46
R6517:Zdbf2	UTSW	1	63305520	missense	possibly damaging	0.81
R6624:Zdbf2	UTSW	1	63303914	missense	possibly damaging	0.46
R6643:Zdbf2	UTSW	1	63304508	missense	possibly damaging	0.82
R6786:Zdbf2	UTSW	1	63304520	missense	possibly damaging	0.46
R6808:Zdbf2	UTSW	1	63308528	missense	possibly damaging	0.66
R6896:Zdbf2	UTSW	1	63308872	missense	probably damaging	0.98
R6997:Zdbf2	UTSW	1	63290766	missense	probably benign	0.09
R7011:Zdbf2	UTSW	1	63306766	missense	possibly damaging	0.66
R7058:Zdbf2	UTSW	1	63307404	missense	possibly damaging	0.66
R7066:Zdbf2	UTSW	1	63307559	missense	probably benign
R7177:Zdbf2	UTSW	1	63294961	missense	possibly damaging	0.94
R7184:Zdbf2	UTSW	1	63306505	missense	possibly damaging	0.92
R7273:Zdbf2	UTSW	1	63303404	missense	possibly damaging	0.90
R7387:Zdbf2	UTSW	1	63304039	missense	possibly damaging	0.46
R7468:Zdbf2	UTSW	1	63307510	missense	probably benign
R7695:Zdbf2	UTSW	1	63307370	missense	possibly damaging	0.83
R7712:Zdbf2	UTSW	1	63305371	missense	possibly damaging	0.83
R7735:Zdbf2	UTSW	1	63304105	missense	possibly damaging	0.66
R7736:Zdbf2	UTSW	1	63308007	nonsense	probably null
R7759:Zdbf2	UTSW	1	63308376	missense	possibly damaging	0.46
R7796:Zdbf2	UTSW	1	63303424	missense	possibly damaging	0.90
R7908:Zdbf2	UTSW	1	63306827	missense	possibly damaging	0.46
R7970:Zdbf2	UTSW	1	63304171	missense	possibly damaging	0.92
R8076:Zdbf2	UTSW	1	63306101	missense	possibly damaging	0.92
R8152:Zdbf2	UTSW	1	63306413	missense	possibly damaging	0.92
R8272:Zdbf2	UTSW	1	63305983	missense	probably benign
R8306:Zdbf2	UTSW	1	63304075	missense	possibly damaging	0.66
R8309:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R8323:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.46
R8400:Zdbf2	UTSW	1	63304976	missense	possibly damaging	0.92
R8443:Zdbf2	UTSW	1	63306007	missense	possibly damaging	0.83
R8460:Zdbf2	UTSW	1	63309570	small deletion	probably benign
R8528:Zdbf2	UTSW	1	63303386	missense	possibly damaging	0.82
R8812:Zdbf2	UTSW	1	63308113	missense	probably benign	0.00
R8962:Zdbf2	UTSW	1	63308003	missense	probably benign	0.00
R9061:Zdbf2	UTSW	1	63307137	missense
R9072:Zdbf2	UTSW	1	63305764	missense	possibly damaging	0.83
R9232:Zdbf2	UTSW	1	63308009	missense	possibly damaging	0.66
R9257:Zdbf2	UTSW	1	63306241	missense	probably damaging	1.00
R9411:Zdbf2	UTSW	1	63304129	missense	probably damaging	0.97
R9470:Zdbf2	UTSW	1	63305625	missense	possibly damaging	0.82
R9606:Zdbf2	UTSW	1	63303377	missense	possibly damaging	0.92
R9621:Zdbf2	UTSW	1	63303476	missense	possibly damaging	0.66
RF021:Zdbf2	UTSW	1	63302652	missense	possibly damaging	0.82
X0018:Zdbf2	UTSW	1	63305351	missense	possibly damaging	0.92
X0027:Zdbf2	UTSW	1	63308007	nonsense	probably null
X0057:Zdbf2	UTSW	1	63305390	missense	possibly damaging	0.66
X0063:Zdbf2	UTSW	1	63305537	missense	probably benign	0.04
Z1176:Zdbf2	UTSW	1	63304245	missense	possibly damaging	0.83
Z1177:Zdbf2	UTSW	1	63304086	frame shift	probably null
Z1177:Zdbf2	UTSW	1	63309203	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CACTGTTTCTGGAGCAACTTCAG -3'
(R):5'- GCTTCCTTCTTGAACAGGCAC -3'

Sequencing Primer
(F):5'- AGCAGTTCTCGTCAGGTGATTACAC -3'
(R):5'- AGGCACCTGGGGATGGTC -3'

Posted On

2020-07-13