Incidental Mutation 'R8195:Ggta1'
ID635382
Institutional Source Beutler Lab
Gene Symbol Ggta1
Ensembl Gene ENSMUSG00000035778
Gene Nameglycoprotein galactosyltransferase alpha 1, 3
SynonymsGgta, glycoprotein alpha galactosyl transferase 1, GALT, Gal, Ggta-1, alpha3GalT, alpha Gal
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8195 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location35400179-35463231 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35422267 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 33 (E33V)
Ref Sequence ENSEMBL: ENSMUSP00000108626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044255] [ENSMUST00000079424] [ENSMUST00000102794] [ENSMUST00000113001] [ENSMUST00000113002] [ENSMUST00000131745] [ENSMUST00000164889]
Predicted Effect probably damaging
Transcript: ENSMUST00000044255
AA Change: E33V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000049408
Gene: ENSMUSG00000035778
AA Change: E33V

DomainStartEndE-ValueType
transmembrane domain 42 60 N/A INTRINSIC
Pfam:Glyco_transf_6 81 404 1.2e-165 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079424
AA Change: E33V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078393
Gene: ENSMUSG00000035778
AA Change: E33V

DomainStartEndE-ValueType
Pfam:Glyco_transf_6 34 370 5.5e-177 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102794
AA Change: E33V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099858
Gene: ENSMUSG00000035778
AA Change: E33V

DomainStartEndE-ValueType
transmembrane domain 42 60 N/A INTRINSIC
Pfam:Glyco_transf_6 74 404 4.3e-182 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113001
AA Change: E33V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108625
Gene: ENSMUSG00000035778
AA Change: E33V

DomainStartEndE-ValueType
Pfam:Glyco_transf_6 45 382 3.6e-177 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113002
AA Change: E33V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108626
Gene: ENSMUSG00000035778
AA Change: E33V

DomainStartEndE-ValueType
transmembrane domain 42 60 N/A INTRINSIC
Pfam:Glyco_transf_6 62 392 3.6e-182 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131745
AA Change: E33V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115112
Gene: ENSMUSG00000035778
AA Change: E33V

DomainStartEndE-ValueType
Pfam:Glyco_transf_6 34 140 1.5e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164889
AA Change: E33V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132408
Gene: ENSMUSG00000035778
AA Change: E33V

DomainStartEndE-ValueType
transmembrane domain 42 60 N/A INTRINSIC
Pfam:Glyco_transf_6 62 392 3.6e-182 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: This gene encodes a member of the galactosyltransferase family of intracellular, membrane-bound enzymes that are involved in the biosynthesis of glycoproteins and glycolipids. The encoded protein catalyzes the transfer of galactose from UDP-galactose to N-acetyllactosamine in an alpha(1,3) linkage to form galactose alpha(1,3)-galactose. Mice lacking the encoded protein develop cortical cataracts. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for disruption of this gene display defects in humoral immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,274,735 G483R probably benign Het
Abca9 T C 11: 110,138,329 D801G probably benign Het
Aldob T C 4: 49,538,822 N232S probably damaging Het
Ankhd1 T C 18: 36,654,177 V322A Het
Arfgef1 T C 1: 10,173,253 K1024E probably damaging Het
Arhgef40 T A 14: 51,988,769 V90E probably damaging Het
Cblc A T 7: 19,785,337 S399R possibly damaging Het
Ccdc17 T A 4: 116,599,014 I368K possibly damaging Het
Ccdc17 T A 4: 116,599,016 W369R probably damaging Het
Cd276 G A 9: 58,537,472 T72I probably damaging Het
Cdk14 C T 5: 5,227,159 probably null Het
Cfap61 C T 2: 145,947,175 S33L probably benign Het
Cmtm2a A G 8: 104,293,038 F7L probably benign Het
Eif2ak4 T C 2: 118,450,338 I1062T possibly damaging Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Fxr1 A T 3: 34,047,729 E204V probably damaging Het
Fzd6 T A 15: 39,031,564 L375Q probably damaging Het
Gnb1l T A 16: 18,544,215 I119N probably benign Het
Gpsm1 A G 2: 26,324,917 probably null Het
Hecw1 A G 13: 14,306,107 I885T probably damaging Het
Itgb8 T C 12: 119,168,170 D580G probably damaging Het
Kbtbd12 T A 6: 88,617,931 T306S possibly damaging Het
Kctd1 C T 18: 15,063,243 E108K unknown Het
Lrrc36 A G 8: 105,452,085 D304G possibly damaging Het
Lrrn2 A G 1: 132,937,344 E49G probably damaging Het
Lysmd2 C A 9: 75,626,028 Y88* probably null Het
Lzts3 A G 2: 130,635,185 S448P probably benign Het
Meioc T A 11: 102,675,067 L447* probably null Het
Mybpc1 A G 10: 88,558,691 I244T possibly damaging Het
Necab3 G A 2: 154,547,443 A160V probably benign Het
Nek8 G T 11: 78,170,761 P314Q possibly damaging Het
Nlrp5 A G 7: 23,413,337 T140A probably benign Het
Olfr655 A T 7: 104,596,926 F85Y probably damaging Het
Olfr763 T C 10: 129,011,575 C97R probably damaging Het
Olfr860 A T 9: 19,846,484 I45N probably damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pgm3 G A 9: 86,570,321 R29W probably damaging Het
Ppp2r3a A G 9: 101,213,032 C31R probably damaging Het
Prom1 C T 5: 44,037,428 S334N possibly damaging Het
Rai14 C T 15: 10,575,216 S581N probably benign Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rgs16 T C 1: 153,740,943 F42S probably benign Het
Slc2a6 T G 2: 27,027,826 E27A probably benign Het
Slc38a1 G A 15: 96,592,566 S110L probably benign Het
Sox30 C T 11: 45,991,765 R541C probably benign Het
Sptbn4 C A 7: 27,408,889 E703* probably null Het
Tjp1 A T 7: 65,343,722 F34L probably damaging Het
Trim65 T C 11: 116,126,211 Q475R probably benign Het
Ttc38 A T 15: 85,844,515 R223* probably null Het
Tulp1 T C 17: 28,364,326 Q80R probably benign Het
Utp23 T C 15: 51,882,202 F139L possibly damaging Het
Vmn1r121 A T 7: 21,098,303 F71I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zdbf2 T C 1: 63,304,066 S535P possibly damaging Het
Zfp788 T G 7: 41,649,377 M479R probably benign Het
Other mutations in Ggta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Ggta1 APN 2 35402450 nonsense probably null
IGL01903:Ggta1 APN 2 35402557 missense possibly damaging 0.74
IGL02796:Ggta1 APN 2 35413317 splice site probably benign
IGL02799:Ggta1 UTSW 2 35422199 missense probably damaging 0.98
R0383:Ggta1 UTSW 2 35402404 missense probably damaging 1.00
R1430:Ggta1 UTSW 2 35408017 missense possibly damaging 0.81
R1667:Ggta1 UTSW 2 35414283 missense possibly damaging 0.83
R1672:Ggta1 UTSW 2 35402133 nonsense probably null
R2246:Ggta1 UTSW 2 35402109 makesense probably null
R3149:Ggta1 UTSW 2 35402623 missense probably damaging 1.00
R3683:Ggta1 UTSW 2 35407988 missense probably benign 0.39
R3684:Ggta1 UTSW 2 35407988 missense probably benign 0.39
R3685:Ggta1 UTSW 2 35407988 missense probably benign 0.39
R4812:Ggta1 UTSW 2 35402723 missense probably benign 0.01
R4856:Ggta1 UTSW 2 35402791 missense possibly damaging 0.59
R5079:Ggta1 UTSW 2 35422237 missense possibly damaging 0.94
R5756:Ggta1 UTSW 2 35402383 missense probably damaging 1.00
R6279:Ggta1 UTSW 2 35407994 missense probably damaging 1.00
R6651:Ggta1 UTSW 2 35402294 missense probably benign 0.00
R6967:Ggta1 UTSW 2 35402722 missense possibly damaging 0.91
R7152:Ggta1 UTSW 2 35402699 missense probably benign 0.00
R7529:Ggta1 UTSW 2 35414244 missense probably damaging 1.00
R7534:Ggta1 UTSW 2 35402428 missense probably damaging 1.00
R7557:Ggta1 UTSW 2 35402536 missense probably damaging 0.98
R7610:Ggta1 UTSW 2 35414218 critical splice donor site probably null
R8153:Ggta1 UTSW 2 35423321 missense possibly damaging 0.53
R8447:Ggta1 UTSW 2 35402561 missense probably damaging 1.00
X0010:Ggta1 UTSW 2 35402719 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCTTATGTTCAGACTGATTGGTC -3'
(R):5'- CACTTGTCGCTGAGTGAGTTAC -3'

Sequencing Primer
(F):5'- AGACTGATTGGTCACTCAGC -3'
(R):5'- TCAGGTCCTGTGAAACCAGAGTTATG -3'
Posted On2020-07-13