Incidental Mutation 'R8195:Cblc'
ID635394
Institutional Source Beutler Lab
Gene Symbol Cblc
Ensembl Gene ENSMUSG00000040525
Gene NameCasitas B-lineage lymphoma c
Synonyms2310076I21Rik, Cbl3, 2310079L19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8195 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location19778881-19796809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19785337 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 399 (S399R)
Ref Sequence ENSEMBL: ENSMUSP00000039955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043822] [ENSMUST00000108449]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043822
AA Change: S399R

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000039955
Gene: ENSMUSG00000040525
AA Change: S399R

DomainStartEndE-ValueType
Pfam:Cbl_N 13 144 2.6e-44 PFAM
Pfam:Cbl_N2 148 231 1.8e-35 PFAM
SH2 234 347 4.35e0 SMART
RING 350 388 1.92e-6 SMART
low complexity region 458 473 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108449
AA Change: S355R

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104088
Gene: ENSMUSG00000040525
AA Change: S355R

DomainStartEndE-ValueType
Pfam:Cbl_N 11 145 7.1e-20 PFAM
Pfam:Cbl_N2 147 231 2.3e-48 PFAM
SH2 234 333 5.28e0 SMART
low complexity region 414 429 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Cbl family of E3 ubiquitin ligases. Cbl proteins play important roles in cell signaling through the ubiquitination and subsequent downregulation of tyrosine kinases. Expression of this gene may be restricted to epithelial cells, and alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no abnormalities of the epithelium or other tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,274,735 G483R probably benign Het
Abca9 T C 11: 110,138,329 D801G probably benign Het
Aldob T C 4: 49,538,822 N232S probably damaging Het
Ankhd1 T C 18: 36,654,177 V322A Het
Arfgef1 T C 1: 10,173,253 K1024E probably damaging Het
Arhgef40 T A 14: 51,988,769 V90E probably damaging Het
Ccdc17 T A 4: 116,599,014 I368K possibly damaging Het
Ccdc17 T A 4: 116,599,016 W369R probably damaging Het
Cd276 G A 9: 58,537,472 T72I probably damaging Het
Cdk14 C T 5: 5,227,159 probably null Het
Cfap61 C T 2: 145,947,175 S33L probably benign Het
Cmtm2a A G 8: 104,293,038 F7L probably benign Het
Eif2ak4 T C 2: 118,450,338 I1062T possibly damaging Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Fxr1 A T 3: 34,047,729 E204V probably damaging Het
Fzd6 T A 15: 39,031,564 L375Q probably damaging Het
Ggta1 T A 2: 35,422,267 E33V probably damaging Het
Gnb1l T A 16: 18,544,215 I119N probably benign Het
Gpsm1 A G 2: 26,324,917 probably null Het
Hecw1 A G 13: 14,306,107 I885T probably damaging Het
Itgb8 T C 12: 119,168,170 D580G probably damaging Het
Kbtbd12 T A 6: 88,617,931 T306S possibly damaging Het
Kctd1 C T 18: 15,063,243 E108K unknown Het
Lrrc36 A G 8: 105,452,085 D304G possibly damaging Het
Lrrn2 A G 1: 132,937,344 E49G probably damaging Het
Lysmd2 C A 9: 75,626,028 Y88* probably null Het
Lzts3 A G 2: 130,635,185 S448P probably benign Het
Meioc T A 11: 102,675,067 L447* probably null Het
Mybpc1 A G 10: 88,558,691 I244T possibly damaging Het
Necab3 G A 2: 154,547,443 A160V probably benign Het
Nek8 G T 11: 78,170,761 P314Q possibly damaging Het
Nlrp5 A G 7: 23,413,337 T140A probably benign Het
Olfr655 A T 7: 104,596,926 F85Y probably damaging Het
Olfr763 T C 10: 129,011,575 C97R probably damaging Het
Olfr860 A T 9: 19,846,484 I45N probably damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pgm3 G A 9: 86,570,321 R29W probably damaging Het
Ppp2r3a A G 9: 101,213,032 C31R probably damaging Het
Prom1 C T 5: 44,037,428 S334N possibly damaging Het
Rai14 C T 15: 10,575,216 S581N probably benign Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rgs16 T C 1: 153,740,943 F42S probably benign Het
Slc2a6 T G 2: 27,027,826 E27A probably benign Het
Slc38a1 G A 15: 96,592,566 S110L probably benign Het
Sox30 C T 11: 45,991,765 R541C probably benign Het
Sptbn4 C A 7: 27,408,889 E703* probably null Het
Tjp1 A T 7: 65,343,722 F34L probably damaging Het
Trim65 T C 11: 116,126,211 Q475R probably benign Het
Ttc38 A T 15: 85,844,515 R223* probably null Het
Tulp1 T C 17: 28,364,326 Q80R probably benign Het
Utp23 T C 15: 51,882,202 F139L possibly damaging Het
Vmn1r121 A T 7: 21,098,303 F71I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zdbf2 T C 1: 63,304,066 S535P possibly damaging Het
Zfp788 T G 7: 41,649,377 M479R probably benign Het
Other mutations in Cblc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Cblc APN 7 19785275 missense probably benign 0.00
R0583:Cblc UTSW 7 19792561 missense probably benign 0.41
R0847:Cblc UTSW 7 19790534 nonsense probably null
R1594:Cblc UTSW 7 19792546 missense probably damaging 1.00
R1626:Cblc UTSW 7 19796502 missense probably damaging 1.00
R1719:Cblc UTSW 7 19790474 missense probably benign 0.00
R1894:Cblc UTSW 7 19792577 missense probably damaging 0.99
R2011:Cblc UTSW 7 19784822 missense probably benign 0.01
R2395:Cblc UTSW 7 19785380 missense probably damaging 1.00
R2852:Cblc UTSW 7 19780964 splice site probably null
R3832:Cblc UTSW 7 19792172 missense probably damaging 0.98
R4696:Cblc UTSW 7 19796482 missense probably damaging 1.00
R5159:Cblc UTSW 7 19785308 missense probably benign 0.01
R5328:Cblc UTSW 7 19792580 missense possibly damaging 0.68
R5487:Cblc UTSW 7 19784808 missense probably benign 0.06
R5659:Cblc UTSW 7 19792932 missense probably damaging 1.00
R6209:Cblc UTSW 7 19785305 missense possibly damaging 0.47
R6519:Cblc UTSW 7 19792863 missense probably damaging 1.00
R6841:Cblc UTSW 7 19792896 missense probably damaging 1.00
R7371:Cblc UTSW 7 19792903 missense probably benign 0.00
R7417:Cblc UTSW 7 19788974 missense probably benign 0.41
R7494:Cblc UTSW 7 19792812 missense possibly damaging 0.76
R8253:Cblc UTSW 7 19786232 missense probably damaging 1.00
X0028:Cblc UTSW 7 19785273 missense probably benign
Z1177:Cblc UTSW 7 19785278 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TCCAGGACTTCAGTATCAGCC -3'
(R):5'- CCTGGATTCAGAGTATACCAGCC -3'

Sequencing Primer
(F):5'- GGACTTCAGTATCAGCCCTCCTC -3'
(R):5'- TGGATTCAGAGTATACCAGCCACATC -3'
Posted On2020-07-13