Incidental Mutation 'R8195:Tjp1'
ID635398
Institutional Source Beutler Lab
Gene Symbol Tjp1
Ensembl Gene ENSMUSG00000030516
Gene Nametight junction protein 1
SynonymsZO1, ZO-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8195 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location65296165-65527781 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65343722 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 34 (F34L)
Ref Sequence ENSEMBL: ENSMUSP00000099652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032729] [ENSMUST00000102592] [ENSMUST00000206228] [ENSMUST00000206612]
PDB Structure
Interplay between phosphatidyl-inositol-phosphates and claudins upon binding to the 1st PDZ domain of zonula occludens 1 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000032729
AA Change: F34L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032729
Gene: ENSMUSG00000030516
AA Change: F34L

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
PDZ 32 110 1.65e-15 SMART
PDZ 196 264 3.92e-17 SMART
low complexity region 302 324 N/A INTRINSIC
PDZ 431 504 5.94e-17 SMART
SH3 519 583 6.41e-2 SMART
GuKc 606 794 1.28e-49 SMART
low complexity region 810 824 N/A INTRINSIC
low complexity region 893 906 N/A INTRINSIC
low complexity region 1157 1176 N/A INTRINSIC
low complexity region 1246 1257 N/A INTRINSIC
low complexity region 1308 1319 N/A INTRINSIC
low complexity region 1339 1365 N/A INTRINSIC
low complexity region 1389 1400 N/A INTRINSIC
ZU5 1549 1654 1.1e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102592
AA Change: F34L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099652
Gene: ENSMUSG00000030516
AA Change: F34L

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
PDZ 32 110 1.65e-15 SMART
PDZ 196 264 3.92e-17 SMART
low complexity region 302 324 N/A INTRINSIC
PDZ 431 504 5.94e-17 SMART
SH3 519 583 6.41e-2 SMART
GuKc 606 794 1.28e-49 SMART
low complexity region 810 824 N/A INTRINSIC
low complexity region 893 906 N/A INTRINSIC
low complexity region 939 955 N/A INTRINSIC
low complexity region 1237 1256 N/A INTRINSIC
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1388 1399 N/A INTRINSIC
low complexity region 1419 1445 N/A INTRINSIC
low complexity region 1469 1480 N/A INTRINSIC
ZU5 1629 1735 1.84e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000206228
AA Change: F101L

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000206612
AA Change: F34L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein located on a cytoplasmic membrane surface of intercellular tight junctions. The encoded protein may be involved in signal transduction at cell-cell junctions. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele show embryonic lethality and growth retardation, failure of embryo turning and chorioallantoic fusion, defective yolk sac angiogenesis, and increased apoptosis in the notochord, neural tube, somite and allantois. Homozygotes for a reporter allele are overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,274,735 G483R probably benign Het
Abca9 T C 11: 110,138,329 D801G probably benign Het
Aldob T C 4: 49,538,822 N232S probably damaging Het
Ankhd1 T C 18: 36,654,177 V322A Het
Arfgef1 T C 1: 10,173,253 K1024E probably damaging Het
Arhgef40 T A 14: 51,988,769 V90E probably damaging Het
Cblc A T 7: 19,785,337 S399R possibly damaging Het
Ccdc17 T A 4: 116,599,014 I368K possibly damaging Het
Ccdc17 T A 4: 116,599,016 W369R probably damaging Het
Cd276 G A 9: 58,537,472 T72I probably damaging Het
Cdk14 C T 5: 5,227,159 probably null Het
Cfap61 C T 2: 145,947,175 S33L probably benign Het
Cmtm2a A G 8: 104,293,038 F7L probably benign Het
Eif2ak4 T C 2: 118,450,338 I1062T possibly damaging Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Fxr1 A T 3: 34,047,729 E204V probably damaging Het
Fzd6 T A 15: 39,031,564 L375Q probably damaging Het
Ggta1 T A 2: 35,422,267 E33V probably damaging Het
Gnb1l T A 16: 18,544,215 I119N probably benign Het
Gpsm1 A G 2: 26,324,917 probably null Het
Hecw1 A G 13: 14,306,107 I885T probably damaging Het
Itgb8 T C 12: 119,168,170 D580G probably damaging Het
Kbtbd12 T A 6: 88,617,931 T306S possibly damaging Het
Kctd1 C T 18: 15,063,243 E108K unknown Het
Lrrc36 A G 8: 105,452,085 D304G possibly damaging Het
Lrrn2 A G 1: 132,937,344 E49G probably damaging Het
Lysmd2 C A 9: 75,626,028 Y88* probably null Het
Lzts3 A G 2: 130,635,185 S448P probably benign Het
Meioc T A 11: 102,675,067 L447* probably null Het
Mybpc1 A G 10: 88,558,691 I244T possibly damaging Het
Necab3 G A 2: 154,547,443 A160V probably benign Het
Nek8 G T 11: 78,170,761 P314Q possibly damaging Het
Nlrp5 A G 7: 23,413,337 T140A probably benign Het
Olfr655 A T 7: 104,596,926 F85Y probably damaging Het
Olfr763 T C 10: 129,011,575 C97R probably damaging Het
Olfr860 A T 9: 19,846,484 I45N probably damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pgm3 G A 9: 86,570,321 R29W probably damaging Het
Ppp2r3a A G 9: 101,213,032 C31R probably damaging Het
Prom1 C T 5: 44,037,428 S334N possibly damaging Het
Rai14 C T 15: 10,575,216 S581N probably benign Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rgs16 T C 1: 153,740,943 F42S probably benign Het
Slc2a6 T G 2: 27,027,826 E27A probably benign Het
Slc38a1 G A 15: 96,592,566 S110L probably benign Het
Sox30 C T 11: 45,991,765 R541C probably benign Het
Sptbn4 C A 7: 27,408,889 E703* probably null Het
Trim65 T C 11: 116,126,211 Q475R probably benign Het
Ttc38 A T 15: 85,844,515 R223* probably null Het
Tulp1 T C 17: 28,364,326 Q80R probably benign Het
Utp23 T C 15: 51,882,202 F139L possibly damaging Het
Vmn1r121 A T 7: 21,098,303 F71I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zdbf2 T C 1: 63,304,066 S535P possibly damaging Het
Zfp788 T G 7: 41,649,377 M479R probably benign Het
Other mutations in Tjp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Tjp1 APN 7 65301219 missense probably benign
IGL00848:Tjp1 APN 7 65303194 missense probably benign 0.00
IGL01363:Tjp1 APN 7 65302965 missense possibly damaging 0.94
IGL01526:Tjp1 APN 7 65322658 missense probably damaging 1.00
IGL01607:Tjp1 APN 7 65336178 missense possibly damaging 0.94
IGL02223:Tjp1 APN 7 65322601 missense probably damaging 1.00
IGL02341:Tjp1 APN 7 65312634 missense probably damaging 1.00
IGL02347:Tjp1 APN 7 65301064 critical splice donor site probably null
IGL02452:Tjp1 APN 7 65312655 missense probably damaging 1.00
IGL02512:Tjp1 APN 7 65343667 missense probably damaging 1.00
IGL02552:Tjp1 APN 7 65299782 nonsense probably null
IGL02707:Tjp1 APN 7 65329683 nonsense probably null
IGL02707:Tjp1 APN 7 65329682 missense possibly damaging 0.85
IGL02939:Tjp1 APN 7 65314890 missense probably damaging 1.00
IGL03139:Tjp1 APN 7 65340434 splice site probably benign
IGL03273:Tjp1 APN 7 65299799 missense probably damaging 1.00
IGL03391:Tjp1 APN 7 65314969 missense probably damaging 1.00
PIT4453001:Tjp1 UTSW 7 65343614 critical splice donor site probably null
R0012:Tjp1 UTSW 7 65329775 splice site probably benign
R0012:Tjp1 UTSW 7 65329775 splice site probably benign
R0390:Tjp1 UTSW 7 65314990 missense probably damaging 1.00
R0519:Tjp1 UTSW 7 65302921 missense probably benign
R0653:Tjp1 UTSW 7 65314755 missense probably damaging 1.00
R1163:Tjp1 UTSW 7 65323054 missense probably damaging 1.00
R1544:Tjp1 UTSW 7 65302921 missense probably benign
R1634:Tjp1 UTSW 7 65302952 missense possibly damaging 0.94
R1767:Tjp1 UTSW 7 65312553 critical splice donor site probably null
R1771:Tjp1 UTSW 7 65313005 missense probably benign 0.45
R1794:Tjp1 UTSW 7 65323129 missense probably damaging 1.00
R1874:Tjp1 UTSW 7 65319253 missense probably damaging 1.00
R1971:Tjp1 UTSW 7 65324078 missense probably damaging 1.00
R1981:Tjp1 UTSW 7 65312855 missense probably damaging 0.99
R2086:Tjp1 UTSW 7 65312921 missense probably damaging 1.00
R2310:Tjp1 UTSW 7 65329742 missense possibly damaging 0.90
R2942:Tjp1 UTSW 7 65318006 missense probably damaging 1.00
R3974:Tjp1 UTSW 7 65297639 nonsense probably null
R4295:Tjp1 UTSW 7 65323150 missense probably damaging 1.00
R4296:Tjp1 UTSW 7 65318489 missense probably damaging 1.00
R4567:Tjp1 UTSW 7 65306501 missense probably damaging 1.00
R4574:Tjp1 UTSW 7 65322605 missense probably damaging 1.00
R4910:Tjp1 UTSW 7 65343727 missense probably damaging 1.00
R4958:Tjp1 UTSW 7 65336102 nonsense probably null
R5267:Tjp1 UTSW 7 65323049 missense probably damaging 1.00
R5371:Tjp1 UTSW 7 65313311 nonsense probably null
R5422:Tjp1 UTSW 7 65302967 missense probably damaging 0.99
R5514:Tjp1 UTSW 7 65354861 missense probably damaging 1.00
R5652:Tjp1 UTSW 7 65312443 splice site probably null
R5693:Tjp1 UTSW 7 65342663 missense possibly damaging 0.96
R5933:Tjp1 UTSW 7 65302852 missense probably benign 0.29
R6043:Tjp1 UTSW 7 65324089 missense probably damaging 1.00
R6416:Tjp1 UTSW 7 65313205 missense possibly damaging 0.76
R6491:Tjp1 UTSW 7 65337117 missense possibly damaging 0.62
R6525:Tjp1 UTSW 7 65343651 missense probably damaging 1.00
R6658:Tjp1 UTSW 7 65301077 missense possibly damaging 0.82
R6917:Tjp1 UTSW 7 65299688 missense probably damaging 0.99
R6960:Tjp1 UTSW 7 65303015 missense possibly damaging 0.59
R7235:Tjp1 UTSW 7 65318573 missense probably benign 0.16
R7274:Tjp1 UTSW 7 65527652 missense possibly damaging 0.86
R7471:Tjp1 UTSW 7 65314690 missense probably damaging 0.99
R7475:Tjp1 UTSW 7 65322339 missense probably damaging 1.00
R7479:Tjp1 UTSW 7 65301180 missense probably damaging 0.98
R8035:Tjp1 UTSW 7 65342702 missense probably benign 0.34
R8276:Tjp1 UTSW 7 65343796 intron probably benign
X0022:Tjp1 UTSW 7 65302841 missense possibly damaging 0.75
X0027:Tjp1 UTSW 7 65314759 missense probably benign 0.18
Z1177:Tjp1 UTSW 7 65343732 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGGTGTAAATAAGCTGGAATCAC -3'
(R):5'- AGACGTTCTCATAGAATGGACTGATG -3'

Sequencing Primer
(F):5'- AACAGATCCGTGACTAAGGAC -3'
(R):5'- GGACTGATGACTGTAATATGTAACC -3'
Posted On2020-07-13