Incidental Mutation 'R8195:Meioc'
ID 635413
Institutional Source Beutler Lab
Gene Symbol Meioc
Ensembl Gene ENSMUSG00000051455
Gene Name meiosis specific with coiled-coil domain
Synonyms LOC380729, LOC268491, Gm1564
MMRRC Submission 067618-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R8195 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 102556177-102573066 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 102565893 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 447 (L447*)
Ref Sequence ENSEMBL: ENSMUSP00000116246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100378] [ENSMUST00000156590]
AlphaFold A2AG06
Predicted Effect probably null
Transcript: ENSMUST00000100378
AA Change: L503*
SMART Domains Protein: ENSMUSP00000097947
Gene: ENSMUSG00000051455
AA Change: L503*

DomainStartEndE-ValueType
low complexity region 526 537 N/A INTRINSIC
low complexity region 712 728 N/A INTRINSIC
Pfam:DUF4582 757 922 5.1e-89 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000156590
AA Change: L447*
SMART Domains Protein: ENSMUSP00000116246
Gene: ENSMUSG00000051455
AA Change: L447*

DomainStartEndE-ValueType
low complexity region 470 481 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit infertility with small gonads, absent germ cells and arrested meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,224,735 (GRCm39) G483R probably benign Het
Abca9 T C 11: 110,029,155 (GRCm39) D801G probably benign Het
Aldob T C 4: 49,538,822 (GRCm39) N232S probably damaging Het
Ankhd1 T C 18: 36,787,230 (GRCm39) V322A Het
Arfgef1 T C 1: 10,243,478 (GRCm39) K1024E probably damaging Het
Arhgef40 T A 14: 52,226,226 (GRCm39) V90E probably damaging Het
Cblc A T 7: 19,519,262 (GRCm39) S399R possibly damaging Het
Ccdc17 T A 4: 116,456,211 (GRCm39) I368K possibly damaging Het
Ccdc17 T A 4: 116,456,213 (GRCm39) W369R probably damaging Het
Cd276 G A 9: 58,444,755 (GRCm39) T72I probably damaging Het
Cdk14 C T 5: 5,277,159 (GRCm39) probably null Het
Cfap61 C T 2: 145,789,095 (GRCm39) S33L probably benign Het
Cmtm2a A G 8: 105,019,670 (GRCm39) F7L probably benign Het
Eif2ak4 T C 2: 118,280,819 (GRCm39) I1062T possibly damaging Het
Fcnb C T 2: 27,968,330 (GRCm39) S209N possibly damaging Het
Fxr1 A T 3: 34,101,878 (GRCm39) E204V probably damaging Het
Fzd6 T A 15: 38,894,959 (GRCm39) L375Q probably damaging Het
Ggta1 T A 2: 35,312,279 (GRCm39) E33V probably damaging Het
Gnb1l T A 16: 18,362,965 (GRCm39) I119N probably benign Het
Gpsm1 A G 2: 26,214,929 (GRCm39) probably null Het
Hecw1 A G 13: 14,480,692 (GRCm39) I885T probably damaging Het
Itgb8 T C 12: 119,131,905 (GRCm39) D580G probably damaging Het
Kbtbd12 T A 6: 88,594,913 (GRCm39) T306S possibly damaging Het
Kctd1 C T 18: 15,196,300 (GRCm39) E108K unknown Het
Lrrc36 A G 8: 106,178,717 (GRCm39) D304G possibly damaging Het
Lrrn2 A G 1: 132,865,082 (GRCm39) E49G probably damaging Het
Lysmd2 C A 9: 75,533,310 (GRCm39) Y88* probably null Het
Lzts3 A G 2: 130,477,105 (GRCm39) S448P probably benign Het
Mybpc1 A G 10: 88,394,553 (GRCm39) I244T possibly damaging Het
Necab3 G A 2: 154,389,363 (GRCm39) A160V probably benign Het
Nek8 G T 11: 78,061,587 (GRCm39) P314Q possibly damaging Het
Nlrp5 A G 7: 23,112,762 (GRCm39) T140A probably benign Het
Or10p21 T C 10: 128,847,444 (GRCm39) C97R probably damaging Het
Or52ac1 A T 7: 104,246,133 (GRCm39) F85Y probably damaging Het
Or7e169 A T 9: 19,757,780 (GRCm39) I45N probably damaging Het
Or8b54 G A 9: 38,686,577 (GRCm39) V9M noncoding transcript Het
Pgm3 G A 9: 86,452,374 (GRCm39) R29W probably damaging Het
Ppp2r3d A G 9: 101,090,231 (GRCm39) C31R probably damaging Het
Prom1 C T 5: 44,194,770 (GRCm39) S334N possibly damaging Het
Rai14 C T 15: 10,575,302 (GRCm39) S581N probably benign Het
Rbm46 C T 3: 82,772,775 (GRCm39) R119Q probably benign Het
Rgs16 T C 1: 153,616,689 (GRCm39) F42S probably benign Het
Slc2a6 T G 2: 26,917,838 (GRCm39) E27A probably benign Het
Slc38a1 G A 15: 96,490,447 (GRCm39) S110L probably benign Het
Sox30 C T 11: 45,882,592 (GRCm39) R541C probably benign Het
Sptbn4 C A 7: 27,108,314 (GRCm39) E703* probably null Het
Tjp1 A T 7: 64,993,470 (GRCm39) F34L probably damaging Het
Trim65 T C 11: 116,017,037 (GRCm39) Q475R probably benign Het
Ttc38 A T 15: 85,728,716 (GRCm39) R223* probably null Het
Tulp1 T C 17: 28,583,300 (GRCm39) Q80R probably benign Het
Utp23 T C 15: 51,745,598 (GRCm39) F139L possibly damaging Het
Vmn1r121 A T 7: 20,832,228 (GRCm39) F71I probably damaging Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Zdbf2 T C 1: 63,343,225 (GRCm39) S535P possibly damaging Het
Zfp788 T G 7: 41,298,801 (GRCm39) M479R probably benign Het
Other mutations in Meioc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Meioc APN 11 102,565,113 (GRCm39) missense probably benign 0.33
IGL01952:Meioc APN 11 102,563,011 (GRCm39) missense possibly damaging 0.79
IGL02006:Meioc APN 11 102,565,092 (GRCm39) missense probably damaging 1.00
IGL02195:Meioc APN 11 102,565,683 (GRCm39) missense possibly damaging 0.91
IGL02339:Meioc APN 11 102,559,274 (GRCm39) missense probably benign 0.18
IGL02935:Meioc APN 11 102,563,017 (GRCm39) missense probably benign 0.06
IGL03294:Meioc APN 11 102,571,495 (GRCm39) missense probably damaging 1.00
PIT4519001:Meioc UTSW 11 102,570,783 (GRCm39) missense probably damaging 1.00
R0285:Meioc UTSW 11 102,563,017 (GRCm39) missense probably benign 0.06
R0964:Meioc UTSW 11 102,570,857 (GRCm39) missense probably damaging 1.00
R1074:Meioc UTSW 11 102,566,219 (GRCm39) missense probably damaging 1.00
R2024:Meioc UTSW 11 102,566,184 (GRCm39) missense probably benign 0.00
R4012:Meioc UTSW 11 102,566,654 (GRCm39) missense probably damaging 0.99
R4429:Meioc UTSW 11 102,566,546 (GRCm39) missense probably damaging 1.00
R4491:Meioc UTSW 11 102,565,746 (GRCm39) missense possibly damaging 0.84
R4594:Meioc UTSW 11 102,564,992 (GRCm39) missense probably damaging 1.00
R4752:Meioc UTSW 11 102,565,259 (GRCm39) missense probably benign 0.00
R5301:Meioc UTSW 11 102,570,871 (GRCm39) missense probably damaging 1.00
R5352:Meioc UTSW 11 102,566,139 (GRCm39) missense probably benign 0.03
R5646:Meioc UTSW 11 102,566,083 (GRCm39) missense possibly damaging 0.94
R5958:Meioc UTSW 11 102,565,979 (GRCm39) missense probably benign 0.41
R5968:Meioc UTSW 11 102,566,657 (GRCm39) missense probably damaging 0.99
R6157:Meioc UTSW 11 102,559,227 (GRCm39) missense probably damaging 1.00
R6410:Meioc UTSW 11 102,565,860 (GRCm39) missense probably benign 0.00
R6644:Meioc UTSW 11 102,559,286 (GRCm39) critical splice donor site probably null
R7285:Meioc UTSW 11 102,557,168 (GRCm39) missense probably benign 0.00
R7440:Meioc UTSW 11 102,565,063 (GRCm39) missense possibly damaging 0.67
R7815:Meioc UTSW 11 102,566,414 (GRCm39) missense probably damaging 1.00
R7984:Meioc UTSW 11 102,565,432 (GRCm39) missense possibly damaging 0.94
R8009:Meioc UTSW 11 102,567,569 (GRCm39) missense probably damaging 1.00
R8078:Meioc UTSW 11 102,559,226 (GRCm39) nonsense probably null
R8429:Meioc UTSW 11 102,565,032 (GRCm39) missense probably benign 0.06
R8797:Meioc UTSW 11 102,567,686 (GRCm39) nonsense probably null
R8854:Meioc UTSW 11 102,566,589 (GRCm39) missense probably damaging 0.98
R8891:Meioc UTSW 11 102,559,246 (GRCm39) missense probably benign 0.43
R9081:Meioc UTSW 11 102,565,001 (GRCm39) missense probably benign 0.00
R9360:Meioc UTSW 11 102,565,779 (GRCm39) missense probably benign 0.13
R9539:Meioc UTSW 11 102,565,506 (GRCm39) missense probably damaging 0.99
R9549:Meioc UTSW 11 102,556,550 (GRCm39) intron probably benign
R9751:Meioc UTSW 11 102,566,419 (GRCm39) nonsense probably null
Z1177:Meioc UTSW 11 102,557,190 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAAGCCTCACACAGCTTGTC -3'
(R):5'- TGAATTCTTTCTGCACCGTTGTAAC -3'

Sequencing Primer
(F):5'- GCTAATGTCTCTGAAAAGCAACAG -3'
(R):5'- TCTGCACCGTTGTAACTAAAATC -3'
Posted On 2020-07-13