Incidental Mutation 'R8195:Ttc38'
ID635422
Institutional Source Beutler Lab
Gene Symbol Ttc38
Ensembl Gene ENSMUSG00000035944
Gene Nametetratricopeptide repeat domain 38
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R8195 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location85832306-85858822 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 85844515 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 223 (R223*)
Ref Sequence ENSEMBL: ENSMUSP00000114504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124011] [ENSMUST00000146088]
Predicted Effect probably benign
Transcript: ENSMUST00000124011
Predicted Effect probably null
Transcript: ENSMUST00000146088
AA Change: R223*
SMART Domains Protein: ENSMUSP00000114504
Gene: ENSMUSG00000035944
AA Change: R223*

DomainStartEndE-ValueType
SCOP:d1ld8a_ 105 272 1e-7 SMART
low complexity region 342 354 N/A INTRINSIC
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,274,735 G483R probably benign Het
Abca9 T C 11: 110,138,329 D801G probably benign Het
Aldob T C 4: 49,538,822 N232S probably damaging Het
Ankhd1 T C 18: 36,654,177 V322A Het
Arfgef1 T C 1: 10,173,253 K1024E probably damaging Het
Arhgef40 T A 14: 51,988,769 V90E probably damaging Het
Cblc A T 7: 19,785,337 S399R possibly damaging Het
Ccdc17 T A 4: 116,599,014 I368K possibly damaging Het
Ccdc17 T A 4: 116,599,016 W369R probably damaging Het
Cd276 G A 9: 58,537,472 T72I probably damaging Het
Cdk14 C T 5: 5,227,159 probably null Het
Cfap61 C T 2: 145,947,175 S33L probably benign Het
Cmtm2a A G 8: 104,293,038 F7L probably benign Het
Eif2ak4 T C 2: 118,450,338 I1062T possibly damaging Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Fxr1 A T 3: 34,047,729 E204V probably damaging Het
Fzd6 T A 15: 39,031,564 L375Q probably damaging Het
Ggta1 T A 2: 35,422,267 E33V probably damaging Het
Gnb1l T A 16: 18,544,215 I119N probably benign Het
Gpsm1 A G 2: 26,324,917 probably null Het
Hecw1 A G 13: 14,306,107 I885T probably damaging Het
Itgb8 T C 12: 119,168,170 D580G probably damaging Het
Kbtbd12 T A 6: 88,617,931 T306S possibly damaging Het
Kctd1 C T 18: 15,063,243 E108K unknown Het
Lrrc36 A G 8: 105,452,085 D304G possibly damaging Het
Lrrn2 A G 1: 132,937,344 E49G probably damaging Het
Lysmd2 C A 9: 75,626,028 Y88* probably null Het
Lzts3 A G 2: 130,635,185 S448P probably benign Het
Meioc T A 11: 102,675,067 L447* probably null Het
Mybpc1 A G 10: 88,558,691 I244T possibly damaging Het
Necab3 G A 2: 154,547,443 A160V probably benign Het
Nek8 G T 11: 78,170,761 P314Q possibly damaging Het
Nlrp5 A G 7: 23,413,337 T140A probably benign Het
Olfr655 A T 7: 104,596,926 F85Y probably damaging Het
Olfr763 T C 10: 129,011,575 C97R probably damaging Het
Olfr860 A T 9: 19,846,484 I45N probably damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pgm3 G A 9: 86,570,321 R29W probably damaging Het
Ppp2r3a A G 9: 101,213,032 C31R probably damaging Het
Prom1 C T 5: 44,037,428 S334N possibly damaging Het
Rai14 C T 15: 10,575,216 S581N probably benign Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rgs16 T C 1: 153,740,943 F42S probably benign Het
Slc2a6 T G 2: 27,027,826 E27A probably benign Het
Slc38a1 G A 15: 96,592,566 S110L probably benign Het
Sox30 C T 11: 45,991,765 R541C probably benign Het
Sptbn4 C A 7: 27,408,889 E703* probably null Het
Tjp1 A T 7: 65,343,722 F34L probably damaging Het
Trim65 T C 11: 116,126,211 Q475R probably benign Het
Tulp1 T C 17: 28,364,326 Q80R probably benign Het
Utp23 T C 15: 51,882,202 F139L possibly damaging Het
Vmn1r121 A T 7: 21,098,303 F71I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zdbf2 T C 1: 63,304,066 S535P possibly damaging Het
Zfp788 T G 7: 41,649,377 M479R probably benign Het
Other mutations in Ttc38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Ttc38 APN 15 85844462 missense possibly damaging 0.76
IGL01596:Ttc38 APN 15 85836073 missense possibly damaging 0.89
IGL03221:Ttc38 APN 15 85834541 missense probably benign 0.00
hairy UTSW 15 85851601 splice site probably null
Stubble UTSW 15 85844515 nonsense probably null
PIT4431001:Ttc38 UTSW 15 85836127 missense probably benign
R0040:Ttc38 UTSW 15 85841489 missense probably damaging 1.00
R0040:Ttc38 UTSW 15 85841489 missense probably damaging 1.00
R0081:Ttc38 UTSW 15 85856472 missense probably benign 0.04
R0143:Ttc38 UTSW 15 85853719 missense possibly damaging 0.51
R0764:Ttc38 UTSW 15 85846403 splice site probably benign
R1745:Ttc38 UTSW 15 85833172 missense probably damaging 1.00
R1837:Ttc38 UTSW 15 85851563 missense probably damaging 1.00
R2069:Ttc38 UTSW 15 85838788 missense probably damaging 1.00
R2086:Ttc38 UTSW 15 85838727 missense probably benign
R2151:Ttc38 UTSW 15 85851601 splice site probably null
R2228:Ttc38 UTSW 15 85844503 missense probably benign 0.01
R4641:Ttc38 UTSW 15 85844458 missense possibly damaging 0.87
R4705:Ttc38 UTSW 15 85852963 missense probably benign 0.00
R4721:Ttc38 UTSW 15 85838746 missense probably benign
R5037:Ttc38 UTSW 15 85844540 missense probably benign 0.16
R6208:Ttc38 UTSW 15 85841497 missense possibly damaging 0.56
R6454:Ttc38 UTSW 15 85838822 missense probably damaging 1.00
R7326:Ttc38 UTSW 15 85852861 missense probably benign 0.00
R7809:Ttc38 UTSW 15 85838738 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- CTCCTTAGCAATGTGCCGTG -3'
(R):5'- TCCCAGAGAGCTAAGCCATATC -3'

Sequencing Primer
(F):5'- TGGTGGGCAAACACATCC -3'
(R):5'- GAGCTAAGCCATATCTGTAAAGC -3'
Posted On2020-07-13