Incidental Mutation 'R8196:Selp'
ID635429
Institutional Source Beutler Lab
Gene Symbol Selp
Ensembl Gene ENSMUSG00000026580
Gene Nameselectin, platelet
SynonymsGrmp, CD62P, P-selectin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R8196 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location164115264-164150026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 164133921 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 401 (D401V)
Ref Sequence ENSEMBL: ENSMUSP00000123924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162746]
PDB Structure Structure of the SNX17 atypical FERM domain bound to the NPxY motif of P-selectin [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000162746
AA Change: D401V

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123924
Gene: ENSMUSG00000026580
AA Change: D401V

DomainStartEndE-ValueType
CLECT 30 159 2.89e-16 SMART
EGF 162 195 1.97e-4 SMART
CCP 200 257 1.31e-14 SMART
CCP 262 319 4.02e-15 SMART
CCP 324 381 5.91e-13 SMART
CCP 386 443 1.46e-12 SMART
CCP 448 505 3.9e-13 SMART
CCP 510 567 1.95e-13 SMART
CCP 580 637 1.97e-9 SMART
CCP 642 699 3.9e-13 SMART
transmembrane domain 711 733 N/A INTRINSIC
PDB:4GXB|B 741 768 2e-12 PDB
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 140 kDa protein that is stored in the alpha-granules of platelets and Weibel-Palade bodies of endothelial cells. This protein redistributes to the plasma membrane during platelet activation and degranulation and mediates the interaction of activated endothelial cells or platelets with leukocytes. The membrane protein is a calcium-dependent receptor that binds to sialylated forms of Lewis blood group carbohydrate antigens on neutrophils and monocytes. Alternative splice variants may occur but are not well documented. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit mildly attenuated inflammatory responses, increased numbers of circulating neutrophils, lack of leukocyte rolling in mesenteric venules, and increased survival after Plasmodium berghei infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b T A 19: 21,678,660 V102D probably damaging Het
Adam6b T A 12: 113,490,467 D301E probably benign Het
Adnp A C 2: 168,183,172 D734E probably benign Het
Ank2 T A 3: 126,929,883 T932S probably damaging Het
Arhgap20 C A 9: 51,848,977 D709E possibly damaging Het
Atoh1 A G 6: 64,730,242 D307G probably benign Het
Aven C T 2: 112,559,775 R8W probably benign Het
B3galt1 A G 2: 68,118,186 I82V probably benign Het
Chd2 T C 7: 73,468,537 D1111G probably benign Het
Csmd1 T C 8: 16,009,468 D2089G probably benign Het
Dach1 T A 14: 98,018,934 H296L probably damaging Het
Dennd4b T G 3: 90,271,597 L556R probably damaging Het
Dopey1 T A 9: 86,523,098 S326T probably benign Het
Eif2b5 T A 16: 20,502,556 H286Q probably damaging Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Fn3k T A 11: 121,450,396 F292L probably damaging Het
Gm1123 G A 9: 99,023,256 A67V probably benign Het
Hey2 C T 10: 30,834,277 C160Y probably benign Het
Jph2 T A 2: 163,338,701 probably null Het
Lars A G 18: 42,210,101 S1084P possibly damaging Het
Macf1 T C 4: 123,382,704 D6084G probably damaging Het
Mdfic G T 6: 15,740,990 A115S probably benign Het
Mki67 T C 7: 135,695,508 E2599G probably damaging Het
Mtus1 A G 8: 41,056,652 S131P probably benign Het
Muc16 G T 9: 18,645,334 T3221K unknown Het
Olfr147 A G 9: 38,403,608 S245G probably damaging Het
Olfr357 T A 2: 36,996,861 I17N possibly damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pdgfc A G 3: 81,037,504 E23G possibly damaging Het
Pfkp T C 13: 6,605,662 T312A probably benign Het
Pxn A G 5: 115,545,709 E200G probably damaging Het
Rai1 C T 11: 60,185,970 H287Y probably damaging Het
Rap1gap G A 4: 137,717,964 V319I probably benign Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Sh3bp5 A G 14: 31,417,442 V58A probably benign Het
Shpk A T 11: 73,203,949 I64F probably benign Het
Slmap A G 14: 26,468,491 Y171H probably damaging Het
Tmem67 T C 4: 12,075,661 T183A probably benign Het
Tyw1 G T 5: 130,300,021 L549F probably damaging Het
Uhrf2 T A 19: 30,073,929 M301K probably benign Het
Uvssa G A 5: 33,410,967 V532I probably benign Het
Vmn2r113 A T 17: 22,957,964 K574I probably damaging Het
Zfp52 A G 17: 21,561,894 N668S possibly damaging Het
Other mutations in Selp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Selp APN 1 164143892 critical splice acceptor site probably null
IGL02430:Selp APN 1 164126383 missense probably damaging 1.00
IGL02591:Selp APN 1 164130133 missense probably damaging 1.00
IGL02883:Selp APN 1 164130102 missense probably benign 0.00
IGL02945:Selp APN 1 164133929 missense probably damaging 1.00
PIT4812001:Selp UTSW 1 164132263 missense probably benign 0.29
R1571:Selp UTSW 1 164126607 missense probably damaging 1.00
R1731:Selp UTSW 1 164141440 nonsense probably null
R1758:Selp UTSW 1 164132285 missense possibly damaging 0.64
R1834:Selp UTSW 1 164128160 splice site probably null
R1951:Selp UTSW 1 164126512 missense probably benign 0.36
R1953:Selp UTSW 1 164126512 missense probably benign 0.36
R1987:Selp UTSW 1 164142758 missense probably damaging 0.98
R2244:Selp UTSW 1 164137286 nonsense probably null
R2484:Selp UTSW 1 164143954 missense probably benign 0.43
R2484:Selp UTSW 1 164143955 missense probably damaging 1.00
R3440:Selp UTSW 1 164123775 missense probably benign 0.17
R3831:Selp UTSW 1 164132280 nonsense probably null
R3958:Selp UTSW 1 164126286 missense probably benign 0.03
R4795:Selp UTSW 1 164144906 missense probably benign 0.15
R4796:Selp UTSW 1 164144906 missense probably benign 0.15
R4807:Selp UTSW 1 164143936 missense probably damaging 1.00
R4832:Selp UTSW 1 164126340 missense probably damaging 1.00
R4917:Selp UTSW 1 164144906 missense probably damaging 0.99
R4921:Selp UTSW 1 164141397 missense possibly damaging 0.93
R5399:Selp UTSW 1 164126586 missense possibly damaging 0.93
R5734:Selp UTSW 1 164143891 splice site probably benign
R5752:Selp UTSW 1 164137242 missense probably damaging 1.00
R6035:Selp UTSW 1 164141510 missense probably benign 0.44
R6035:Selp UTSW 1 164141510 missense probably benign 0.44
R6185:Selp UTSW 1 164126346 missense probably damaging 1.00
R6555:Selp UTSW 1 164141602 splice site probably null
R6955:Selp UTSW 1 164144909 missense possibly damaging 0.94
R7106:Selp UTSW 1 164126422 missense probably benign 0.12
R7677:Selp UTSW 1 164133956 missense probably damaging 1.00
R7831:Selp UTSW 1 164145015 critical splice donor site probably null
R8494:Selp UTSW 1 164130266 critical splice donor site probably null
R8870:Selp UTSW 1 164137218 missense probably damaging 0.96
Z1176:Selp UTSW 1 164126432 missense probably benign 0.00
Z1177:Selp UTSW 1 164144898 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGGACTTCCAAGTTAAACAAGCC -3'
(R):5'- ACCACCTCAGATATAGCCTTTAAG -3'

Sequencing Primer
(F):5'- GATGATCATTGAACCGAGTCATCC -3'
(R):5'- AGAATATTGCCTTCAACTTACTGC -3'
Posted On2020-07-13