Incidental Mutation 'R8196:Fcnb'
ID 635430
Institutional Source Beutler Lab
Gene Symbol Fcnb
Ensembl Gene ENSMUSG00000026835
Gene Name ficolin B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8196 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 28076378-28084885 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 28078318 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 209 (S209N)
Ref Sequence ENSEMBL: ENSMUSP00000028179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028179] [ENSMUST00000117486] [ENSMUST00000135472]
AlphaFold O70497
Predicted Effect possibly damaging
Transcript: ENSMUST00000028179
AA Change: S209N

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028179
Gene: ENSMUSG00000026835
AA Change: S209N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Collagen 39 99 1.1e-11 PFAM
FBG 101 314 1.78e-115 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117486
AA Change: S209N

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112625
Gene: ENSMUSG00000026835
AA Change: S209N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Collagen 39 99 6.7e-12 PFAM
FBG 101 250 1.33e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135472
SMART Domains Protein: ENSMUSP00000119098
Gene: ENSMUSG00000026835

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Collagen 38 81 5.3e-10 PFAM
internal_repeat_1 86 107 1.19e-5 PROSPERO
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ficolin family of proteins are characterized by the presence of a leader peptide, a short N-terminal segment, followed by a collagen-like region, and a C-terminal fibrinogen-like domain. The collagen-like and the fibrinogen-like domains are also found separately in other proteins such as complement protein C1q, C-type lectins known as collectins, and tenascins. However, all these proteins recognize different targets, and are functionally distinct. Ficolin 1 encoded by FCN1 is predominantly expressed in the peripheral blood leukocytes, and has been postulated to function as a plasma protein with elastin-binding activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to Streptococcus pneumoniae infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b T A 19: 21,678,660 V102D probably damaging Het
Adam6b T A 12: 113,490,467 D301E probably benign Het
Adnp A C 2: 168,183,172 D734E probably benign Het
Ank2 T A 3: 126,929,883 T932S probably damaging Het
Arhgap20 C A 9: 51,848,977 D709E possibly damaging Het
Atoh1 A G 6: 64,730,242 D307G probably benign Het
Aven C T 2: 112,559,775 R8W probably benign Het
B3galt1 A G 2: 68,118,186 I82V probably benign Het
Chd2 T C 7: 73,468,537 D1111G probably benign Het
Csmd1 T C 8: 16,009,468 D2089G probably benign Het
Dach1 T A 14: 98,018,934 H296L probably damaging Het
Dennd4b T G 3: 90,271,597 L556R probably damaging Het
Dopey1 T A 9: 86,523,098 S326T probably benign Het
Eif2b5 T A 16: 20,502,556 H286Q probably damaging Het
Fn3k T A 11: 121,450,396 F292L probably damaging Het
Gm1123 G A 9: 99,023,256 A67V probably benign Het
Hey2 C T 10: 30,834,277 C160Y probably benign Het
Jph2 T A 2: 163,338,701 probably null Het
Lars A G 18: 42,210,101 S1084P possibly damaging Het
Macf1 T C 4: 123,382,704 D6084G probably damaging Het
Mdfic G T 6: 15,740,990 A115S probably benign Het
Mki67 T C 7: 135,695,508 E2599G probably damaging Het
Mtus1 A G 8: 41,056,652 S131P probably benign Het
Muc16 G T 9: 18,645,334 T3221K unknown Het
Olfr147 A G 9: 38,403,608 S245G probably damaging Het
Olfr357 T A 2: 36,996,861 I17N possibly damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pdgfc A G 3: 81,037,504 E23G possibly damaging Het
Pfkp T C 13: 6,605,662 T312A probably benign Het
Pxn A G 5: 115,545,709 E200G probably damaging Het
Rai1 C T 11: 60,185,970 H287Y probably damaging Het
Rap1gap G A 4: 137,717,964 V319I probably benign Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Selp A T 1: 164,133,921 D401V possibly damaging Het
Sh3bp5 A G 14: 31,417,442 V58A probably benign Het
Shpk A T 11: 73,203,949 I64F probably benign Het
Slmap A G 14: 26,468,491 Y171H probably damaging Het
Tmem67 T C 4: 12,075,661 T183A probably benign Het
Tyw1 G T 5: 130,300,021 L549F probably damaging Het
Uhrf2 T A 19: 30,073,929 M301K probably benign Het
Uvssa G A 5: 33,410,967 V532I probably benign Het
Vmn2r113 A T 17: 22,957,964 K574I probably damaging Het
Zfp52 A G 17: 21,561,894 N668S possibly damaging Het
Other mutations in Fcnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Fcnb APN 2 28076801 missense probably benign 0.04
IGL02130:Fcnb APN 2 28084789 critical splice donor site probably null
IGL02348:Fcnb APN 2 28084830 missense possibly damaging 0.88
IGL02504:Fcnb APN 2 28076594 missense probably damaging 1.00
IGL03118:Fcnb APN 2 28076618 missense probably benign 0.06
IGL03179:Fcnb APN 2 28076634 missense possibly damaging 0.93
R0217:Fcnb UTSW 2 28079677 missense probably benign 0.02
R0899:Fcnb UTSW 2 28076779 missense probably damaging 1.00
R3901:Fcnb UTSW 2 28079196 missense probably damaging 1.00
R5845:Fcnb UTSW 2 28079621 critical splice donor site probably null
R5911:Fcnb UTSW 2 28076689 missense probably damaging 1.00
R6065:Fcnb UTSW 2 28079910 missense probably damaging 1.00
R6188:Fcnb UTSW 2 28079190 missense possibly damaging 0.94
R6488:Fcnb UTSW 2 28078289 missense probably damaging 1.00
R8058:Fcnb UTSW 2 28079695 missense probably damaging 1.00
R8194:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8195:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8198:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8199:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8678:Fcnb UTSW 2 28078349 missense possibly damaging 0.61
R9224:Fcnb UTSW 2 28079148 missense probably damaging 1.00
R9261:Fcnb UTSW 2 28079624 missense probably damaging 0.99
X0024:Fcnb UTSW 2 28076691 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCGCTGATGTCAACCCTAGG -3'
(R):5'- AAAGATGTTGGTACCTACCCCGG -3'

Sequencing Primer
(F):5'- TGATGTCAACCCTAGGCTCAAGG -3'
(R):5'- CCCGGTGAATTCCAAGTTCAG -3'
Posted On 2020-07-13