Mutagenetix > Incidental Mutations

Incidental Mutation 'R8196:Fcnb'

635430

Institutional Source

Beutler Lab

Gene Symbol

Fcnb

Ensembl Gene

ENSMUSG00000026835

Gene Name

ficolin B

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8196 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

28076378-28084885 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 28078318 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 209 (S209N)

Ref Sequence

ENSEMBL: ENSMUSP00000028179 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028179] [ENSMUST00000117486] [ENSMUST00000135472]

AlphaFold

O70497

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028179
AA Change: S209N

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000028179
Gene: ENSMUSG00000026835
AA Change: S209N

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Pfam:Collagen	39	99	1.1e-11	PFAM
FBG	101	314	1.78e-115	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117486
AA Change: S209N

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000112625
Gene: ENSMUSG00000026835
AA Change: S209N

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Pfam:Collagen	39	99	6.7e-12	PFAM
FBG	101	250	1.33e-41	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000135472

SMART Domains

Protein: ENSMUSP00000119098
Gene: ENSMUSG00000026835

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Pfam:Collagen	38	81	5.3e-10	PFAM
internal_repeat_1	86	107	1.19e-5	PROSPERO

Meta Mutation Damage Score

0.1712

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ficolin family of proteins are characterized by the presence of a leader peptide, a short N-terminal segment, followed by a collagen-like region, and a C-terminal fibrinogen-like domain. The collagen-like and the fibrinogen-like domains are also found separately in other proteins such as complement protein C1q, C-type lectins known as collectins, and tenascins. However, all these proteins recognize different targets, and are functionally distinct. Ficolin 1 encoded by FCN1 is predominantly expressed in the peripheral blood leukocytes, and has been postulated to function as a plasma protein with elastin-binding activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to Streptococcus pneumoniae infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd17b	T	A	19: 21,678,660	V102D	probably damaging	Het
Adam6b	T	A	12: 113,490,467	D301E	probably benign	Het
Adnp	A	C	2: 168,183,172	D734E	probably benign	Het
Ank2	T	A	3: 126,929,883	T932S	probably damaging	Het
Arhgap20	C	A	9: 51,848,977	D709E	possibly damaging	Het
Atoh1	A	G	6: 64,730,242	D307G	probably benign	Het
Aven	C	T	2: 112,559,775	R8W	probably benign	Het
B3galt1	A	G	2: 68,118,186	I82V	probably benign	Het
Chd2	T	C	7: 73,468,537	D1111G	probably benign	Het
Csmd1	T	C	8: 16,009,468	D2089G	probably benign	Het
Dach1	T	A	14: 98,018,934	H296L	probably damaging	Het
Dennd4b	T	G	3: 90,271,597	L556R	probably damaging	Het
Dopey1	T	A	9: 86,523,098	S326T	probably benign	Het
Eif2b5	T	A	16: 20,502,556	H286Q	probably damaging	Het
Fn3k	T	A	11: 121,450,396	F292L	probably damaging	Het
Gm1123	G	A	9: 99,023,256	A67V	probably benign	Het
Hey2	C	T	10: 30,834,277	C160Y	probably benign	Het
Jph2	T	A	2: 163,338,701		probably null	Het
Lars	A	G	18: 42,210,101	S1084P	possibly damaging	Het
Macf1	T	C	4: 123,382,704	D6084G	probably damaging	Het
Mdfic	G	T	6: 15,740,990	A115S	probably benign	Het
Mki67	T	C	7: 135,695,508	E2599G	probably damaging	Het
Mtus1	A	G	8: 41,056,652	S131P	probably benign	Het
Muc16	G	T	9: 18,645,334	T3221K	unknown	Het
Olfr147	A	G	9: 38,403,608	S245G	probably damaging	Het
Olfr357	T	A	2: 36,996,861	I17N	possibly damaging	Het
Olfr921	G	A	9: 38,775,281	V9M	noncoding transcript	Het
Pdgfc	A	G	3: 81,037,504	E23G	possibly damaging	Het
Pfkp	T	C	13: 6,605,662	T312A	probably benign	Het
Pxn	A	G	5: 115,545,709	E200G	probably damaging	Het
Rai1	C	T	11: 60,185,970	H287Y	probably damaging	Het
Rap1gap	G	A	4: 137,717,964	V319I	probably benign	Het
Rbm46	C	T	3: 82,865,468	R119Q	probably benign	Het
Selp	A	T	1: 164,133,921	D401V	possibly damaging	Het
Sh3bp5	A	G	14: 31,417,442	V58A	probably benign	Het
Shpk	A	T	11: 73,203,949	I64F	probably benign	Het
Slmap	A	G	14: 26,468,491	Y171H	probably damaging	Het
Tmem67	T	C	4: 12,075,661	T183A	probably benign	Het
Tyw1	G	T	5: 130,300,021	L549F	probably damaging	Het
Uhrf2	T	A	19: 30,073,929	M301K	probably benign	Het
Uvssa	G	A	5: 33,410,967	V532I	probably benign	Het
Vmn2r113	A	T	17: 22,957,964	K574I	probably damaging	Het
Zfp52	A	G	17: 21,561,894	N668S	possibly damaging	Het

Other mutations in Fcnb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Fcnb	APN	2	28076801	missense	probably benign	0.04
IGL02130:Fcnb	APN	2	28084789	critical splice donor site	probably null
IGL02348:Fcnb	APN	2	28084830	missense	possibly damaging	0.88
IGL02504:Fcnb	APN	2	28076594	missense	probably damaging	1.00
IGL03118:Fcnb	APN	2	28076618	missense	probably benign	0.06
IGL03179:Fcnb	APN	2	28076634	missense	possibly damaging	0.93
R0217:Fcnb	UTSW	2	28079677	missense	probably benign	0.02
R0899:Fcnb	UTSW	2	28076779	missense	probably damaging	1.00
R3901:Fcnb	UTSW	2	28079196	missense	probably damaging	1.00
R5845:Fcnb	UTSW	2	28079621	critical splice donor site	probably null
R5911:Fcnb	UTSW	2	28076689	missense	probably damaging	1.00
R6065:Fcnb	UTSW	2	28079910	missense	probably damaging	1.00
R6188:Fcnb	UTSW	2	28079190	missense	possibly damaging	0.94
R6488:Fcnb	UTSW	2	28078289	missense	probably damaging	1.00
R8058:Fcnb	UTSW	2	28079695	missense	probably damaging	1.00
R8194:Fcnb	UTSW	2	28078318	missense	possibly damaging	0.65
R8195:Fcnb	UTSW	2	28078318	missense	possibly damaging	0.65
R8198:Fcnb	UTSW	2	28078318	missense	possibly damaging	0.65
R8199:Fcnb	UTSW	2	28078318	missense	possibly damaging	0.65
R8678:Fcnb	UTSW	2	28078349	missense	possibly damaging	0.61
R9224:Fcnb	UTSW	2	28079148	missense	probably damaging	1.00
R9261:Fcnb	UTSW	2	28079624	missense	probably damaging	0.99
X0024:Fcnb	UTSW	2	28076691	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCGCTGATGTCAACCCTAGG -3'
(R):5'- AAAGATGTTGGTACCTACCCCGG -3'

Sequencing Primer
(F):5'- TGATGTCAACCCTAGGCTCAAGG -3'
(R):5'- CCCGGTGAATTCCAAGTTCAG -3'

Posted On

2020-07-13